View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF8217_high_14 (Length: 218)
Name: NF8217_high_14
Description: NF8217
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF8217_high_14 |
 | |
|
Alignment Details
Target: chr1 (Bit Score: 179; Significance: 9e-97; HSPs: 1)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 179; E-Value: 9e-97
Query Start/End: Original strand, 1 - 200
Target Start/End: Original strand, 4269234 - 4269437
Alignment:
| Q |
1 |
cgttggcaagacagtgttgctcaggcacatatctaaaaaatatcctacctataattaaaggaagaatctcaatacctaaatcaaaacatcacata----a |
96 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||| | |
|
|
| T |
4269234 |
cgttggcaagacagtgttgctcaggcacatatctaaaaaatatcctacctataattaaaggaagaatctctatacctaaatcaaaacatcacatacttga |
4269333 |
T |
|
| Q |
97 |
tatctttaggttttgaattaatatgatattcaacttatttgcgtgattgtttaaaattcattgtgatgatccatcaaccgatttctcctcatgagtcatg |
196 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
4269334 |
tatctttaggttttgaattaatatgatattcaacttatttccgtgattgtttaaaattcattgtgatgatccatcaaccgatttctcctcatgagtcatg |
4269433 |
T |
|
| Q |
197 |
accc |
200 |
Q |
| |
|
|||| |
|
|
| T |
4269434 |
accc |
4269437 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University