View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF8217_low_10 (Length: 253)
Name: NF8217_low_10
Description: NF8217
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF8217_low_10 |
 |  |
|
Alignment Details
Target: chr8 (Bit Score: 202; Significance: 1e-110; HSPs: 1)
Name: chr8
Description:
Target: chr8; HSP #1
Raw Score: 202; E-Value: 1e-110
Query Start/End: Original strand, 18 - 243
Target Start/End: Original strand, 14853943 - 14854168
Alignment:
| Q |
18 |
cttccttctagcacaacgttaagatctgccttagagaacatttgtaccataaatttgttatcatccattggcaacagcttcatcttcatcaccggacacc |
117 |
Q |
| |
|
|||||||| ||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
14853943 |
cttccttccagcacaacgttaagatctgccttagagaacatttgtaccatgaatttgttatcatccattggcaacagcttcatcttcatcaccggacacc |
14854042 |
T |
 |
| Q |
118 |
acatgttacccagtctgccttcgatggtggataagtggataggtttgttcaccactactcttccaataaggcaaaggtcgagcagttcaatggaagacaa |
217 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||| |
|
|
| T |
14854043 |
acatgttacccagtctgccttcgatggtggataagtggacaggtttgttcaccactactcttccaataaggcagaggtcgagcagttcaatggaagacaa |
14854142 |
T |
 |
| Q |
218 |
agttggttgattcacacctccgtctc |
243 |
Q |
| |
|
|| |||||||||||||||||||||| |
|
|
| T |
14854143 |
agcaggttgattcacacctccgtctc |
14854168 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University