View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF8217_low_12 (Length: 233)
Name: NF8217_low_12
Description: NF8217
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF8217_low_12 |
 |  |
|
Alignment Details
Target: chr1 (Bit Score: 155; Significance: 2e-82; HSPs: 1)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 155; E-Value: 2e-82
Query Start/End: Original strand, 12 - 214
Target Start/End: Complemental strand, 7818565 - 7818354
Alignment:
| Q |
12 |
agcagagaagaagcaaaaacatcatacataaaagagaaatgataataaagttctttctcagtgattctt----gtgaacggattggagagaattgtattg |
107 |
Q |
| |
|
|||| |||||||||| ||||||||||||||||||||||| |||||||||||||||||||| |||||||| ||||||||||||||||||||||||||| |
|
|
| T |
7818565 |
agcaaagaagaagcacaaacatcatacataaaagagaaacgataataaagttctttctcactgattctttcttgtgaacggattggagagaattgtattg |
7818466 |
T |
 |
| Q |
108 |
ggaaaaacccaa-----atataggtctttttgtacaaagaatttcacacatcaaagattgaatcgaccgttccaccttttctacattttgtcttccacaa |
202 |
Q |
| |
|
||||||||| || ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
7818465 |
ggaaaaacctaagtctaatataggtctttttgtacaaagaatttcacacatcaaagattgaatcgaccgttccaccttttctacattttgtcttccacaa |
7818366 |
T |
 |
| Q |
203 |
caatattatcct |
214 |
Q |
| |
|
|||||||||||| |
|
|
| T |
7818365 |
caatattatcct |
7818354 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University