View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF8218_high_3 (Length: 316)
Name: NF8218_high_3
Description: NF8218
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF8218_high_3 |
 |  |
|
Alignment Details
Target: chr5 (Bit Score: 283; Significance: 1e-158; HSPs: 1)
Name: chr5
Description:
Target: chr5; HSP #1
Raw Score: 283; E-Value: 1e-158
Query Start/End: Original strand, 13 - 299
Target Start/End: Original strand, 43044433 - 43044719
Alignment:
| Q |
13 |
ggtggattaaacttcaacttcgccaatagcgacaataaactctacaaatgaataaaattaaattaacgaatcttaattgaactcttaatacaacagcgaa |
112 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
43044433 |
ggtggattaaacttcaacttcgccaatagcgacaataaactctacaaatgaataaaattaaattaacgaatcttaattgaactcttaatacaacagcgaa |
43044532 |
T |
 |
| Q |
113 |
tttacatcaaaccaaagaaaaaggagaaaggatcctcaagactcagaaagaaaaatatgggaaattatatgcatgtacttatttatgagttgaagttgaa |
212 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
43044533 |
tttacatcaaaccaaagaaaaaggagaaaggatcctcaagactcagaatgaaaaatatgggaaattatatgcatgtacttatttatgagttgaagttgaa |
43044632 |
T |
 |
| Q |
213 |
ctcaaacgttggaagcaaggtttggcttggaatattgtggtggaggagatgatgaagggaaggaactatttgcagcagcagtgcctg |
299 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
43044633 |
ctcaaacgttggaagcaaggtttggcttggaatattgtggtggaggagatgatgaagggaaggaactatttgcagcagcagtgcctg |
43044719 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University