View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF8218_low_2 (Length: 347)
Name: NF8218_low_2
Description: NF8218
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF8218_low_2 |
 | |
|
Alignment Details
Target: chr5 (Bit Score: 289; Significance: 1e-162; HSPs: 2)
Name: chr5
Description:
Target: chr5; HSP #1
Raw Score: 289; E-Value: 1e-162
Query Start/End: Original strand, 25 - 341
Target Start/End: Original strand, 36651195 - 36651511
Alignment:
| Q |
25 |
atccacactccaccacattagacacaaccgccaagctataactcataaccattagatatcccttgaggaacacatgttacatgtcagttttaacgaggag |
124 |
Q |
| |
|
||||||||||||||||||||||| |||| ||||||||||||||||||||||||||||||||||||||||||||||||| |||||| |||||||||||||| |
|
|
| T |
36651195 |
atccacactccaccacattagacgcaactgccaagctataactcataaccattagatatcccttgaggaacacatgtttcatgtcggttttaacgaggag |
36651294 |
T |
|
| Q |
125 |
acgctgatgtatgtaattcaattcagcctcatacaccccatttacactcatcaatttcttgtacagatattcaatggttttgcgtgacttcattccagac |
224 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||| |
|
|
| T |
36651295 |
acgctgatgtatgtaattcaattcagcctcatacaccccatttacactcatcaatttcttgtacagatattcaatggtttcgcgtgacttcattccagat |
36651394 |
T |
|
| Q |
225 |
cttgccacaattgcagatgtagtctctaactgaatggagcttttcatgagatagctttcggtcaaaatgaactcgtgactaagactttctttctcaagcg |
324 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
36651395 |
cttgccacaattgcagatgtagtctctaactgaatggagcttttcatgagatagctttcggtcaaaatgaactcgtgactaagactttctttctcaagcg |
36651494 |
T |
|
| Q |
325 |
gtttatctctctgcttc |
341 |
Q |
| |
|
|||||||||| |||||| |
|
|
| T |
36651495 |
gtttatctctgtgcttc |
36651511 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #2
Raw Score: 37; E-Value: 0.000000000008
Query Start/End: Original strand, 61 - 137
Target Start/End: Complemental strand, 36642257 - 36642181
Alignment:
| Q |
61 |
tataactcataaccattagatatcccttgaggaacacatgttacatgtcagttttaacgaggagacgctgatgtatg |
137 |
Q |
| |
|
|||||||||||||||| |||||||| |||||||||||||| ||||| || | || |||||||||||| ||||||| |
|
|
| T |
36642257 |
tataactcataaccatgagatatcctttgaggaacacatgcctcatgttaggtctagcgaggagacgctaatgtatg |
36642181 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University