View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF8221_high_12 (Length: 250)
Name: NF8221_high_12
Description: NF8221
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF8221_high_12 |
 |  |
|
Alignment Details
Target: chr8 (Bit Score: 79; Significance: 5e-37; HSPs: 2)
Name: chr8
Description:
Target: chr8; HSP #1
Raw Score: 79; E-Value: 5e-37
Query Start/End: Original strand, 1 - 104
Target Start/End: Original strand, 7206388 - 7206491
Alignment:
| Q |
1 |
cactatctttgttttaacaagtttcgttnnnnnnntatgcatgtcattttaaaattgagataactcacataaatatgctagatttgtcccactcctttgt |
100 |
Q |
| |
|
|||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| || |
|
|
| T |
7206388 |
cactatctttgttttaacaagtttcgttaaaaaaatatgcatgtcattttaaaattgagataactcacataaatatgctagatttgtcccactccttagt |
7206487 |
T |
 |
| Q |
101 |
ttct |
104 |
Q |
| |
|
|||| |
|
|
| T |
7206488 |
ttct |
7206491 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #2
Raw Score: 66; E-Value: 3e-29
Query Start/End: Original strand, 177 - 242
Target Start/End: Original strand, 7206563 - 7206628
Alignment:
| Q |
177 |
gcaataatgtcttttttcatttctacgattcgaattcacaaacttcaaacaatgattgttcatctc |
242 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
7206563 |
gcaataatgtcttttttcatttctacgattcgaattcacaaacttcaaacaatgattgttcatctc |
7206628 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University