View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF8221_low_13 (Length: 268)
Name: NF8221_low_13
Description: NF8221
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF8221_low_13 |
 |  |
|
Alignment Details
Target: chr2 (Bit Score: 201; Significance: 1e-110; HSPs: 1)
Name: chr2
Description:
Target: chr2; HSP #1
Raw Score: 201; E-Value: 1e-110
Query Start/End: Original strand, 18 - 258
Target Start/End: Complemental strand, 33468380 - 33468140
Alignment:
| Q |
18 |
gtgaatatataaaaattgttacttcaaggtggacgcgcattaagttgaattccactgtcgaaacaaaaattggccaagttgccttagattttttaaggca |
117 |
Q |
| |
|
|||||||||||||||||||| |||||||||||| |||||||||||||||||| |||||| |||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
33468380 |
gtgaatatataaaaattgttgcttcaaggtggatgcgcattaagttgaattctactgtcaaaacaaaaattggccaagttgccttagattttttaaggca |
33468281 |
T |
 |
| Q |
118 |
attagtcatatataaggtttggactgtggttttggatacttcaagatggcagaaactgtaaaagagccaaggtcattggccttgacacctacctggtctg |
217 |
Q |
| |
|
||| ||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||| ||||||||||| | |
|
|
| T |
33468280 |
attcgtcatatataaggttcggactgtggttttggatacttcaagatggcagaaactgtaaaagaaccaaggtcattggccttgactcctacctggtccg |
33468181 |
T |
 |
| Q |
218 |
tcgccactgtgttgaccatctttgttgccgtctctctgctt |
258 |
Q |
| |
|
||||||||||||||||||||||||||||||||||| ||||| |
|
|
| T |
33468180 |
tcgccactgtgttgaccatctttgttgccgtctctttgctt |
33468140 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University