View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF8222_high_16 (Length: 236)
Name: NF8222_high_16
Description: NF8222
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF8222_high_16 |
 | |
|
Alignment Details
Target: chr2 (Bit Score: 154; Significance: 8e-82; HSPs: 1)
Name: chr2
Description:
Target: chr2; HSP #1
Raw Score: 154; E-Value: 8e-82
Query Start/End: Original strand, 19 - 223
Target Start/End: Complemental strand, 19468453 - 19468248
Alignment:
| Q |
19 |
tcaagtcccgtcataaacttttgcattttggggcaatataggg-cacccatcccactaggatttaccgaattctccatcagtgtggtatataacaaatag |
117 |
Q |
| |
|
||||| ||| |||||| |||||||||||||||||||||||||| |||||||||||| ||||||| |||||||||||||||||||||||||||| |||||| |
|
|
| T |
19468453 |
tcaagccccatcataaccttttgcattttggggcaatataggggcacccatcccaccaggatttcccgaattctccatcagtgtggtatataaaaaatag |
19468354 |
T |
|
| Q |
118 |
caataaaatgaggatagtacgagaaaaataccttccaagttaggattggaagattaatcatgaagaaatcttcatgtttctgtcaaacatcagagtacaa |
217 |
Q |
| |
|
||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||| |||||||||||||| ||||| |||||||||| ||||||| |
|
|
| T |
19468353 |
caataaaatgaggatagtacgagaaaaataccttcgaagttaggattggaagattaatcaggaagaaatcttcatatttctttcaaacatcaaagtacaa |
19468254 |
T |
|
| Q |
218 |
acacca |
223 |
Q |
| |
|
|||||| |
|
|
| T |
19468253 |
acacca |
19468248 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University