View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF8222_low_15 (Length: 263)
Name: NF8222_low_15
Description: NF8222
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF8222_low_15 |
 |  |
|
Alignment Details
Target: chr3 (Bit Score: 101; Significance: 4e-50; HSPs: 2)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 101; E-Value: 4e-50
Query Start/End: Original strand, 2 - 198
Target Start/End: Original strand, 15275150 - 15275348
Alignment:
| Q |
2 |
tgatatgttatagtacaatattttgagaatagtgatatttgatgctgacaaaaagaagatttgaatctaaacttgag--nnnnnnnnccctcttaactta |
99 |
Q |
| |
|
||||||||||||||||||| ||||| ||||||||||||||||||||||||||||||||||||||| ||||||||||| |||||| |||||| |
|
|
| T |
15275150 |
tgatatgttatagtacaatgttttgggaatagtgatatttgatgctgacaaaaagaagatttgaacctaaacttgagtttttcttttccctctcaactta |
15275249 |
T |
 |
| Q |
100 |
cacggttatctatttgttaggatgtaatgtggcc-gggatttttgtgtgcaatgtaacaaaaccaacctcatcatttagttagatgacatcatgttagtt |
198 |
Q |
| |
|
|||||||| |||||||||||||||||||||| || | | |||||||||||||||||| | |||||||| | ||| ||||||||||||||||||||||||| |
|
|
| T |
15275250 |
cacggttacctatttgttaggatgtaatgtgaccagaggtttttgtgtgcaatgtaatagaaccaaccacgtca-ttagttagatgacatcatgttagtt |
15275348 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #2
Raw Score: 63; E-Value: 2e-27
Query Start/End: Original strand, 182 - 244
Target Start/End: Original strand, 15279968 - 15280030
Alignment:
| Q |
182 |
atgacatcatgttagttattcatggttatttggttgattaaagtaatttatagacagctttta |
244 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
15279968 |
atgacatcatgttagttattcatggttatttggttgattaaagtaatttatagacagctttta |
15280030 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University