View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF8222_low_16 (Length: 255)
Name: NF8222_low_16
Description: NF8222
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF8222_low_16 |
 | |
|
Alignment Details
Target: chr3 (Bit Score: 132; Significance: 1e-68; HSPs: 2)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 132; E-Value: 1e-68
Query Start/End: Original strand, 116 - 247
Target Start/End: Original strand, 51170223 - 51170354
Alignment:
| Q |
116 |
cacttgcagaaaatcaaacatgaaaataactacattagaacgttgtgggatcccaatttattcgggttttcaaattattgaattcaacttgcatctattg |
215 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
51170223 |
cacttgcagaaaatcaaacatgaaaataactacattagaacgttgtgggatcccaatttattcgggttttcaaattattgaattcaacttgcatctattg |
51170322 |
T |
|
| Q |
216 |
gagtttacttttcttttgatggtacttcttct |
247 |
Q |
| |
|
|||||||||||||||||||||||||||||||| |
|
|
| T |
51170323 |
gagtttacttttcttttgatggtacttcttct |
51170354 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #2
Raw Score: 30; E-Value: 0.00000009
Query Start/End: Original strand, 79 - 108
Target Start/End: Original strand, 51169993 - 51170022
Alignment:
| Q |
79 |
ttggtgttatgcttctggcttagaagagtg |
108 |
Q |
| |
|
|||||||||||||||||||||||||||||| |
|
|
| T |
51169993 |
ttggtgttatgcttctggcttagaagagtg |
51170022 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University