View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF8222_low_18 (Length: 245)
Name: NF8222_low_18
Description: NF8222
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF8222_low_18 |
 | |
|
Alignment Details
Target: chr1 (Bit Score: 206; Significance: 1e-113; HSPs: 1)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 206; E-Value: 1e-113
Query Start/End: Original strand, 22 - 227
Target Start/End: Original strand, 31641671 - 31641876
Alignment:
| Q |
22 |
gaggaggaggagaagagaggttggtgtgaaaatttggagattcaggcttgatgttgtggtggagagtattattaaggttgctagggttagggttttgttg |
121 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
31641671 |
gaggaggaggagaagagaggttggtgtgaaaatttggagattcaggcttgatgttgtggtggagagtattattaaggttgctagggttagggttttgttg |
31641770 |
T |
|
| Q |
122 |
aggtgggtcccaggtgatgtggctttgtgggttttggaaactttgttgttgatttgggaagaggaaaagagattggactaatgggtttgtgtttgtggtg |
221 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
31641771 |
aggtgggtcccaggtgatgtggctttgtgggttttggaaactttgttgttgatttgggaagaggaaaagagattggactaatgggtttgtgtttgtggtg |
31641870 |
T |
|
| Q |
222 |
gtgatg |
227 |
Q |
| |
|
|||||| |
|
|
| T |
31641871 |
gtgatg |
31641876 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University