View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: NF8222_low_23 (Length: 236)

Name: NF8222_low_23
Description: NF8222
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] NF8222_low_23
NF8222_low_23
[»] chr2 (1 HSPs)
chr2 (19-223)||(19468248-19468453)


Alignment Details
Target: chr2 (Bit Score: 154; Significance: 8e-82; HSPs: 1)
Name: chr2
Description:

Target: chr2; HSP #1
Raw Score: 154; E-Value: 8e-82
Query Start/End: Original strand, 19 - 223
Target Start/End: Complemental strand, 19468453 - 19468248
Alignment:
19 tcaagtcccgtcataaacttttgcattttggggcaatataggg-cacccatcccactaggatttaccgaattctccatcagtgtggtatataacaaatag 117  Q
    ||||| ||| |||||| |||||||||||||||||||||||||| |||||||||||| ||||||| |||||||||||||||||||||||||||| ||||||    
19468453 tcaagccccatcataaccttttgcattttggggcaatataggggcacccatcccaccaggatttcccgaattctccatcagtgtggtatataaaaaatag 19468354  T
118 caataaaatgaggatagtacgagaaaaataccttccaagttaggattggaagattaatcatgaagaaatcttcatgtttctgtcaaacatcagagtacaa 217  Q
    ||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||| |||||||||||||| ||||| |||||||||| |||||||    
19468353 caataaaatgaggatagtacgagaaaaataccttcgaagttaggattggaagattaatcaggaagaaatcttcatatttctttcaaacatcaaagtacaa 19468254  T
218 acacca 223  Q
    ||||||    
19468253 acacca 19468248  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Oklahoma State University