View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: NF8222_low_24 (Length: 220)

Name: NF8222_low_24
Description: NF8222
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] NF8222_low_24
NF8222_low_24
[»] chr4 (1 HSPs)
chr4 (1-202)||(33594049-33594250)
[»] chr5 (1 HSPs)
chr5 (138-170)||(29458057-29458089)


Alignment Details
Target: chr4 (Bit Score: 194; Significance: 1e-105; HSPs: 1)
Name: chr4
Description:

Target: chr4; HSP #1
Raw Score: 194; E-Value: 1e-105
Query Start/End: Original strand, 1 - 202
Target Start/End: Original strand, 33594049 - 33594250
Alignment:
1 atgtaaacaagctgaggaaaataggttatttggtgctattaatgctgctccagctgttactcttttgccttggggacttttgaagagaaagaaggtgctt 100  Q
    ||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||    
33594049 atgtaaacaagctgaggaaaataggttatttggtgctattaatgctgctcctgctgttactcttttgccttggggacttttgaagagaaagaaggtgctt 33594148  T
101 tactttagttttagagatattggagtttgatttcgtgcatgtttggattgaccgtgagtttgacaaaattctattgcttgtcaattgtgattatgacaaa 200  Q
    |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||    
33594149 tactttagttttagagatattggagtttgatttcgtgcatgtttggattgaccgtgagtttgacaaaattctattgcttgtcaattgtgattctgacaaa 33594248  T
201 ct 202  Q
    ||    
33594249 ct 33594250  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr5 (Bit Score: 29; Significance: 0.0000003; HSPs: 1)
Name: chr5
Description:

Target: chr5; HSP #1
Raw Score: 29; E-Value: 0.0000003
Query Start/End: Original strand, 138 - 170
Target Start/End: Original strand, 29458057 - 29458089
Alignment:
138 catgtttggattgaccgtgagtttgacaaaatt 170  Q
    |||||||||||||| ||||||||||||||||||    
29458057 catgtttggattgatcgtgagtttgacaaaatt 29458089  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Oklahoma State University