View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF8222_low_24 (Length: 220)
Name: NF8222_low_24
Description: NF8222
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF8222_low_24 |
 | |
|
Alignment Details
Target: chr4 (Bit Score: 194; Significance: 1e-105; HSPs: 1)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 194; E-Value: 1e-105
Query Start/End: Original strand, 1 - 202
Target Start/End: Original strand, 33594049 - 33594250
Alignment:
| Q |
1 |
atgtaaacaagctgaggaaaataggttatttggtgctattaatgctgctccagctgttactcttttgccttggggacttttgaagagaaagaaggtgctt |
100 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
33594049 |
atgtaaacaagctgaggaaaataggttatttggtgctattaatgctgctcctgctgttactcttttgccttggggacttttgaagagaaagaaggtgctt |
33594148 |
T |
|
| Q |
101 |
tactttagttttagagatattggagtttgatttcgtgcatgtttggattgaccgtgagtttgacaaaattctattgcttgtcaattgtgattatgacaaa |
200 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||| |
|
|
| T |
33594149 |
tactttagttttagagatattggagtttgatttcgtgcatgtttggattgaccgtgagtttgacaaaattctattgcttgtcaattgtgattctgacaaa |
33594248 |
T |
|
| Q |
201 |
ct |
202 |
Q |
| |
|
|| |
|
|
| T |
33594249 |
ct |
33594250 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5 (Bit Score: 29; Significance: 0.0000003; HSPs: 1)
Name: chr5
Description:
Target: chr5; HSP #1
Raw Score: 29; E-Value: 0.0000003
Query Start/End: Original strand, 138 - 170
Target Start/End: Original strand, 29458057 - 29458089
Alignment:
| Q |
138 |
catgtttggattgaccgtgagtttgacaaaatt |
170 |
Q |
| |
|
|||||||||||||| |||||||||||||||||| |
|
|
| T |
29458057 |
catgtttggattgatcgtgagtttgacaaaatt |
29458089 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University