View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF8222_low_8 (Length: 365)
Name: NF8222_low_8
Description: NF8222
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF8222_low_8 |
 | |
|
Alignment Details
Target: chr2 (Bit Score: 44; Significance: 6e-16; HSPs: 1)
Name: chr2
Description:
Target: chr2; HSP #1
Raw Score: 44; E-Value: 6e-16
Query Start/End: Original strand, 303 - 346
Target Start/End: Original strand, 43557100 - 43557143
Alignment:
| Q |
303 |
ttttggttccagaagtaatttattgctatataaaaggtgcttga |
346 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
43557100 |
ttttggttccagaagtaatttattgctatataaaaggtgcttga |
43557143 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University