View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF8223_high_14 (Length: 220)
Name: NF8223_high_14
Description: NF8223
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF8223_high_14 |
 |  |
|
Alignment Details
Target: chr5 (Bit Score: 188; Significance: 1e-102; HSPs: 1)
Name: chr5
Description:
Target: chr5; HSP #1
Raw Score: 188; E-Value: 1e-102
Query Start/End: Original strand, 18 - 205
Target Start/End: Complemental strand, 35688312 - 35688125
Alignment:
| Q |
18 |
ttctcaggtttagttcttgaattcttagaagctttcacagtgacagtttcttccacaacatcttttttggtatcatcaacatcaacagtgtcttcttcta |
117 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
35688312 |
ttctcaggtttagttcttgaattcttagaagctttcacagtgacagtttcttccacaacatcttttttggtatcatcaacatcaacagtgtcttcttcta |
35688213 |
T |
 |
| Q |
118 |
caaccactttctttgtatctttttgtaatgactcgatcttattcggtttttcttgatgggtttcttgtactttaggccttgaaaatgg |
205 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
35688212 |
caaccactttctttgtatctttttgtaatgactcgatcttattcggtttttcttgatgggtttcttgtactttaggccttgaaaatgg |
35688125 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University