View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF8223_high_3 (Length: 357)
Name: NF8223_high_3
Description: NF8223
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF8223_high_3 |
 |  |
|
Alignment Details
Target: chr1 (Bit Score: 283; Significance: 1e-158; HSPs: 1)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 283; E-Value: 1e-158
Query Start/End: Original strand, 18 - 353
Target Start/End: Original strand, 31081090 - 31081427
Alignment:
| Q |
18 |
gaacctgcatctcctttattcaccac-catctcctctgcatgggacaaatgataaatattcacagtccataatggcgtcagttgtgacgaacgagttata |
116 |
Q |
| |
|
|||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
31081090 |
gaacctgcatctcctttattcaccactcatctcctctgcatgggacaaatgataaatattcacagtccataatggcgtcagttgtgacgaacgagttata |
31081189 |
T |
 |
| Q |
117 |
atgaagtaagcaaaatacataaaagttaggtaaggccaatattttcttgtggcaaatttgggaatgaaatacatttctttatttctttttaatactattt |
216 |
Q |
| |
|
||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
31081190 |
atgaagtaagcaaaatacataaaagttagataaggccaatattttcttgtggcaaatttgggaatgaaatacatttctttatttctttttaatactattt |
31081289 |
T |
 |
| Q |
217 |
ctttgtctttggccaaataacatttagatatagttagacgtttattatgtatgaactactttttaag-nnnnnnnnncttttgctacatattgatttttt |
315 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||| |
|
|
| T |
31081290 |
ctttgtctttggccaaataacatttagatatagttagacgtttattatgtatgaactactttttaagttttctttttcttttgctacatattgatttttt |
31081389 |
T |
 |
| Q |
316 |
aggccataaattattttcacaattaccttcttctcact |
353 |
Q |
| |
|
||||||||||||||||||||||||||| |||| ||||| |
|
|
| T |
31081390 |
aggccataaattattttcacaattaccctcttttcact |
31081427 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University