View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF8223_low_19 (Length: 229)
Name: NF8223_low_19
Description: NF8223
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF8223_low_19 |
 |  |
|
Alignment Details
Target: chr8 (Bit Score: 94; Significance: 5e-46; HSPs: 2)
Name: chr8
Description:
Target: chr8; HSP #1
Raw Score: 94; E-Value: 5e-46
Query Start/End: Original strand, 89 - 223
Target Start/End: Complemental strand, 6088599 - 6088465
Alignment:
| Q |
89 |
actaggtctcttgtttctattatctcatattgaggaagtttttcacgttaaaaattcggcgtctttgatatttaannnnnnngttattgtgctttgaaat |
188 |
Q |
| |
|
||||||||||| ||||||||||||||||||||||||| ||||||||| |||| ||| |||||||||||||||||| |||||||||||||||||| |
|
|
| T |
6088599 |
actaggtctctcgtttctattatctcatattgaggaaatttttcacgataaatatttggcgtctttgatatttaatttttttgttattgtgctttgaaat |
6088500 |
T |
 |
| Q |
189 |
ttgttttggatggttgtttatttaattgcacatat |
223 |
Q |
| |
|
||||||||||||||||||||||||||||||||||| |
|
|
| T |
6088499 |
ttgttttggatggttgtttatttaattgcacatat |
6088465 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #2
Raw Score: 71; E-Value: 3e-32
Query Start/End: Original strand, 26 - 104
Target Start/End: Complemental strand, 6088720 - 6088642
Alignment:
| Q |
26 |
ttatgggtcttgttccctagcgttattagaaagaatattgagtacccattattttacatctagactaggtctcttgttt |
104 |
Q |
| |
|
||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||| |||| |
|
|
| T |
6088720 |
ttatgggtcttgttccctagcgttattagaaaggatattgagtacccattattttacatctagactaggtctctcgttt |
6088642 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University