View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF8223_low_3 (Length: 495)
Name: NF8223_low_3
Description: NF8223
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF8223_low_3 |
 | |
|
Alignment Details
Target: chr7 (Bit Score: 397; Significance: 0; HSPs: 1)
Name: chr7
Description:
Target: chr7; HSP #1
Raw Score: 397; E-Value: 0
Query Start/End: Original strand, 1 - 481
Target Start/End: Original strand, 10343683 - 10344163
Alignment:
| Q |
1 |
ttcattcaattccattattttctttctaaaaataatatctactgcactctaagtttttcatcgtgttgtcgtcccttctaatctaaagtgttcttgttca |
100 |
Q |
| |
|
||||||||||||||| |||||||||||||||||||| |||||| |||||||||||||||||||||||||||||||||||||||||||||||| ||||||| |
|
|
| T |
10343683 |
ttcattcaattccatgattttctttctaaaaataatctctacttcactctaagtttttcatcgtgttgtcgtcccttctaatctaaagtgttgttgttca |
10343782 |
T |
|
| Q |
101 |
agatgtagatggtgggtagtagtggtgtgaagatgggtcagcaatgtgcatcgcctcttgcaccagttctcttcggcggtgtttagtctaaacaccaagt |
200 |
Q |
| |
|
|||||||||||||||||||| |||||||||||||||||||||||| ||||| |||||||||||| |||||||||||| |||||| ||||||||||||||| |
|
|
| T |
10343783 |
agatgtagatggtgggtagtggtggtgtgaagatgggtcagcaatctgcattgcctcttgcacctgttctcttcggcagtgttttgtctaaacaccaagt |
10343882 |
T |
|
| Q |
201 |
ttcaaggcgcgtcttgtgttagtttggtggttgcgtcagtggtttgggttcactcagatcgcgctttcgcgacttggtccatgttgatcggtcatatgtt |
300 |
Q |
| |
|
||||||| || |||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
10343883 |
ttcaaggtgcatcttgtgttagtttggcggttgcgtcagtggtttgggttcactcagatcgcgctttcgcgacttggtccatgttgatcggtcatatgtt |
10343982 |
T |
|
| Q |
301 |
ttggtgatatttactattggattttgagtcatgattttcactgttttgtctctgcctacactgtgtgccgcatcagaggatgtatttcagggagatctgg |
400 |
Q |
| |
|
|||||||||| ||||||||||||||||||||||||||||||| |||||||||||| | |||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
10343983 |
ttggtgatatatactattggattttgagtcatgattttcactattttgtctctgcttgcactgtgtgccgcatcagaggatgtatttcagggagatctgg |
10344082 |
T |
|
| Q |
401 |
gtctaggtctagttttgctgctgggctcagattgtactgtcgaggcttggttctgttgttctataatgcgcttggtgatgt |
481 |
Q |
| |
|
|||||||||| |||||||| |||||||||||||||||||||| ||||| |||||||||||||||||||||||||||||||| |
|
|
| T |
10344083 |
gtctaggtctggttttgctactgggctcagattgtactgtcgcggcttcgttctgttgttctataatgcgcttggtgatgt |
10344163 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University