View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF8225_high_3 (Length: 256)
Name: NF8225_high_3
Description: NF8225
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF8225_high_3 |
 | |
|
Alignment Details
Target: chr7 (Bit Score: 186; Significance: 1e-101; HSPs: 1)
Name: chr7
Description:
Target: chr7; HSP #1
Raw Score: 186; E-Value: 1e-101
Query Start/End: Original strand, 1 - 237
Target Start/End: Complemental strand, 32350235 - 32349992
Alignment:
| Q |
1 |
aatttgagccttatggctaagtggaaatgagactacttcaagaggacatacatttttggaaagtggtgttga-------gagaaaaatatggtgacacta |
93 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||| |
|
|
| T |
32350235 |
aatttgagccttatggctaagtggaaatgagactacttcaagaggacatacatttttggaaagtggtgttgactattgagagaaaaatatggtgacacta |
32350136 |
T |
|
| Q |
94 |
tttccggtttccctcaggaggaagggattagatggctgcagttttctttcagatggtggaaggatttgatgactttataaggaagtgttggtgtcaatca |
193 |
Q |
| |
|
||| ||||||||||| ||||||||||| |||||||| ||||||||||| | |||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
32350135 |
ttttcggtttccctccggaggaagggactagatggccgcagttttcttccggatggtggaaggatttgatgactttataaggaagtgttggtgtcaatcg |
32350036 |
T |
|
| Q |
194 |
gtgtacgaatagggtggtgcggaaggtttcaaatgggaggggga |
237 |
Q |
| |
|
|| ||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
32350035 |
gtttacgaatagggtggtgcggaaggtttcaaatgggaggggga |
32349992 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4 (Bit Score: 35; Significance: 0.00000000009; HSPs: 1)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 35; E-Value: 0.00000000009
Query Start/End: Original strand, 55 - 129
Target Start/End: Complemental strand, 1467402 - 1467328
Alignment:
| Q |
55 |
tttggaaagtggtgttgagagaaaaatatggtgacactatttccggtttccctcaggaggaagggattagatggc |
129 |
Q |
| |
|
||||||||||||||||| | |||||||||||||| ||||||||||||| | | |||||| |||| |||||||| |
|
|
| T |
1467402 |
tttggaaagtggtgttgcgcgaaaaatatggtgatgatatttccggtttcaccccggaggatgggaatagatggc |
1467328 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8 (Bit Score: 33; Significance: 0.000000001; HSPs: 1)
Name: chr8
Description:
Target: chr8; HSP #1
Raw Score: 33; E-Value: 0.000000001
Query Start/End: Original strand, 1 - 88
Target Start/End: Complemental strand, 37485868 - 37485780
Alignment:
| Q |
1 |
aatttgagccttatggctaagtggaaatga-gactacttcaagaggacatacatttttggaaagtggtgttgagagaaaaatatggtga |
88 |
Q |
| |
|
|||||||| |||||||| ||||||||||| | | ||||||||||| ||| | |||||||||||||||||||||| || |||||||| |
|
|
| T |
37485868 |
aatttgagtcttatggcgaagtggaaatggcgtatccttcaagaggatttacctctttggaaagtggtgttgagagataagtatggtga |
37485780 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1 (Bit Score: 31; Significance: 0.00000002; HSPs: 1)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 31; E-Value: 0.00000002
Query Start/End: Original strand, 55 - 85
Target Start/End: Complemental strand, 28061267 - 28061237
Alignment:
| Q |
55 |
tttggaaagtggtgttgagagaaaaatatgg |
85 |
Q |
| |
|
||||||||||||||||||||||||||||||| |
|
|
| T |
28061267 |
tttggaaagtggtgttgagagaaaaatatgg |
28061237 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University