View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF8226_high_21 (Length: 404)
Name: NF8226_high_21
Description: NF8226
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF8226_high_21 |
 | |
|
Alignment Details
Target: chr8 (Bit Score: 218; Significance: 1e-120; HSPs: 2)
Name: chr8
Description:
Target: chr8; HSP #1
Raw Score: 218; E-Value: 1e-120
Query Start/End: Original strand, 163 - 384
Target Start/End: Complemental strand, 41294906 - 41294685
Alignment:
| Q |
163 |
aatttaatagcacttctaatttgagagtttaatcttttggttacagttaacacaaagtttaatggtataccttcagaaaaagttttatgtgtttccaact |
262 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
41294906 |
aatttaatagcacttctaatttgagagtttaatcttttggttacagttaacacaaagtttaatggtataccttcagaaaaagttttatgtgtttccaact |
41294807 |
T |
|
| Q |
263 |
atatatgtttcaatgcttgtgatttatatatggactaacactgaacttactataacgcagttaagatggaatcattatctaaattagctttatcccggcg |
362 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||| |
|
|
| T |
41294806 |
atatatgtttcaatgcttgtgatttatatatggactaacactgaacttactataacgcagttgagatggaatcattatctaaattagctttatcccggcg |
41294707 |
T |
|
| Q |
363 |
ttccgaaaactagatgagtatt |
384 |
Q |
| |
|
|||||||||||||||||||||| |
|
|
| T |
41294706 |
ttccgaaaactagatgagtatt |
41294685 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #2
Raw Score: 74; E-Value: 8e-34
Query Start/End: Original strand, 1 - 74
Target Start/End: Complemental strand, 41295042 - 41294969
Alignment:
| Q |
1 |
gcatctttttctttcttcattttcatttatcgtcaaatatgcctctccacgcggatgacttttgcgatacttat |
74 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
41295042 |
gcatctttttctttcttcattttcatttatcgtcaaatatgcctctccacgcggatgacttttgcgatacttat |
41294969 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University