View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: NF8226_high_36 (Length: 262)

Name: NF8226_high_36
Description: NF8226
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] NF8226_high_36
NF8226_high_36
[»] chr7 (2 HSPs)
chr7 (177-251)||(814125-814199)
chr7 (17-49)||(814321-814353)


Alignment Details
Target: chr7 (Bit Score: 71; Significance: 3e-32; HSPs: 2)
Name: chr7
Description:

Target: chr7; HSP #1
Raw Score: 71; E-Value: 3e-32
Query Start/End: Original strand, 177 - 251
Target Start/End: Complemental strand, 814199 - 814125
Alignment:
177 cgagtcctcgaggatatggaggttagttcaaagaattcgtggattgcttgtgatggagtgaaaagtaacattctt 251  Q
    |||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||    
814199 cgagtcctcgaggatatggaggttagttcaaagaattcgtcgattgcttgtgatggagtgaaaagtaacattctt 814125  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr7; HSP #2
Raw Score: 33; E-Value: 0.000000001
Query Start/End: Original strand, 17 - 49
Target Start/End: Complemental strand, 814353 - 814321
Alignment:
17 atcatgtcgtaactattattataacaacttcag 49  Q
    |||||||||||||||||||||||||||||||||    
814353 atcatgtcgtaactattattataacaacttcag 814321  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Oklahoma State University