View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF8226_high_37 (Length: 259)
Name: NF8226_high_37
Description: NF8226
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF8226_high_37 |
 |  |
|
Alignment Details
Target: chr1 (Bit Score: 170; Significance: 3e-91; HSPs: 1)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 170; E-Value: 3e-91
Query Start/End: Original strand, 19 - 218
Target Start/End: Complemental strand, 46920547 - 46920349
Alignment:
| Q |
19 |
ggtacgacctaagatggaacaatgtgttgaaacagctgattcgagtaaactacctagtaggttttgaggatgtatgttcattgtgnnnnnnngatgatgt |
118 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||| |||||||| |
|
|
| T |
46920547 |
ggtacgacctaagatggaacaatgtgttgaaacagctgattcgagtaaacaacctagtaggttttgaggatgtatgttcattgtgtttttt-gatgatgt |
46920449 |
T |
 |
| Q |
119 |
taaggttaaatggtgtatgagcgtttatttggattttggtacgaattgcatcagttctcatgcagcgatgttgacttctcatgtttttcaacagatattt |
218 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
46920448 |
taaggttaaatggtgtatgagcgtttatttggattttggtacgaattgcatcagttctcatgcagcgatgttgacttctcatgtttttcaacagatattt |
46920349 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5 (Bit Score: 109; Significance: 6e-55; HSPs: 1)
Name: chr5
Description:
Target: chr5; HSP #1
Raw Score: 109; E-Value: 6e-55
Query Start/End: Original strand, 19 - 157
Target Start/End: Complemental strand, 38310704 - 38310567
Alignment:
| Q |
19 |
ggtacgacctaagatggaacaatgtgttgaaacagctgattcgagtaaactacctagtaggttttgaggatgtatgttcattgtgnnnnnnngatgatgt |
118 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||| |
|
|
| T |
38310704 |
ggtacgacctaagatggaacaatgtgttgaaacagctgattcgagtaaactacctagtaggttttgaggatgtatgttcattgtg-ttttttgatgatgt |
38310606 |
T |
 |
| Q |
119 |
taaggttaaatggtgtatgagcgtttatttggattttgg |
157 |
Q |
| |
|
||||||||||||||||||||| ||||||||||||||||| |
|
|
| T |
38310605 |
taaggttaaatggtgtatgagggtttatttggattttgg |
38310567 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University