View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF8226_high_50 (Length: 220)
Name: NF8226_high_50
Description: NF8226
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF8226_high_50 |
 |  |
|
| [»] chr2 (4 HSPs) |
 |  |
|
Alignment Details
Target: chr2 (Bit Score: 144; Significance: 7e-76; HSPs: 4)
Name: chr2
Description:
Target: chr2; HSP #1
Raw Score: 144; E-Value: 7e-76
Query Start/End: Original strand, 9 - 220
Target Start/End: Original strand, 5390296 - 5390506
Alignment:
| Q |
9 |
attgtatagattttgttattttagtgaaatgttaacatgtgtcttaaaaacttatgttaatgaatataatgtggatannnnnnnnngaaaattgtgaatt |
108 |
Q |
| |
|
|||||||| |||||||||||||||||||||| ||||||||| |||||||||| ||||||||||||||||| |||||| |||||||||| ||| |
|
|
| T |
5390296 |
attgtataaattttgttattttagtgaaatgctaacatgtgccttaaaaactcatgttaatgaatataatatggatatttttttt-gaaaattgtgcatt |
5390394 |
T |
 |
| Q |
109 |
taacgacacatgttaatatgaattattttatttgtcaataccgcagattggtgagttggctggacttgcagttggatctactgtgcttctaaatgttatg |
208 |
Q |
| |
|
|||||||||||||||||||||||||||| |||||||||||| |||||||||||||||||| ||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
5390395 |
taacgacacatgttaatatgaattatttgatttgtcaatactgcagattggtgagttggccggacttgcagttggatctactgtgcttctaaatgttatg |
5390494 |
T |
 |
| Q |
209 |
tttgccgggtat |
220 |
Q |
| |
|
|||||||||||| |
|
|
| T |
5390495 |
tttgccgggtat |
5390506 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #2
Raw Score: 74; E-Value: 4e-34
Query Start/End: Original strand, 131 - 220
Target Start/End: Original strand, 5403964 - 5404053
Alignment:
| Q |
131 |
ttattttatttgtcaataccgcagattggtgagttggctggacttgcagttggatctactgtgcttctaaatgttatgtttgccgggtat |
220 |
Q |
| |
|
||||||| |||||||||||| |||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||| |||||| |
|
|
| T |
5403964 |
ttattttgtttgtcaataccacagattggtgagttggctggacttgcagttggatctaccgtgcttctaaatgttatgtttgctgggtat |
5404053 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #3
Raw Score: 37; E-Value: 0.000000000005
Query Start/End: Original strand, 152 - 220
Target Start/End: Complemental strand, 5406865 - 5406797
Alignment:
| Q |
152 |
cagattggtgagttggctggacttgcagttggatctactgtgcttctaaatgttatgtttgccgggtat |
220 |
Q |
| |
|
||||||||||| |||||||||||||||||||||||||| || | |||||||| ||||||| |||||| |
|
|
| T |
5406865 |
cagattggtgaattggctggacttgcagttggatctacagtcatgctaaatgtgttgtttgcagggtat |
5406797 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #4
Raw Score: 36; E-Value: 0.00000000002
Query Start/End: Original strand, 153 - 220
Target Start/End: Original strand, 5398255 - 5398322
Alignment:
| Q |
153 |
agattggtgagttggctggacttgcagttggatctactgtgcttctaaatgttatgtttgccgggtat |
220 |
Q |
| |
|
|||||||||| |||||||||||||||||||||||||| || | |||||||| ||||||| |||||| |
|
|
| T |
5398255 |
agattggtgaattggctggacttgcagttggatctaccgttatactaaatgtgctgtttgcggggtat |
5398322 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8 (Bit Score: 41; Significance: 0.00000000000002; HSPs: 1)
Name: chr8
Description:
Target: chr8; HSP #1
Raw Score: 41; E-Value: 0.00000000000002
Query Start/End: Original strand, 151 - 219
Target Start/End: Original strand, 36268798 - 36268866
Alignment:
| Q |
151 |
gcagattggtgagttggctggacttgcagttggatctactgtgcttctaaatgttatgtttgccgggta |
219 |
Q |
| |
|
||||||||||||||||||||| ||||||||||||||||||| ||| | ||||| |||||||| ||||| |
|
|
| T |
36268798 |
gcagattggtgagttggctgggattgcagttggatctactgtacttttgaatgtgatgtttgcagggta |
36268866 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University