View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: NF8226_high_51 (Length: 218)

Name: NF8226_high_51
Description: NF8226
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] NF8226_high_51
NF8226_high_51
[»] chr1 (8 HSPs)
chr1 (1-209)||(32248609-32248817)
chr1 (2-209)||(32242872-32243079)
chr1 (27-111)||(32242813-32242897)
chr1 (2-89)||(32253444-32253531)
chr1 (27-111)||(32253385-32253469)
chr1 (2-209)||(32253402-32253603)
chr1 (2-95)||(32242830-32242923)
chr1 (13-95)||(32248579-32248661)


Alignment Details
Target: chr1 (Bit Score: 209; Significance: 1e-114; HSPs: 8)
Name: chr1
Description:

Target: chr1; HSP #1
Raw Score: 209; E-Value: 1e-114
Query Start/End: Original strand, 1 - 209
Target Start/End: Original strand, 32248609 - 32248817
Alignment:
Q  1 catgtccgggacgtcttggatcccattctctttctttctgactatgtccgggacgtcttgggtctcgttctctttcttcctggctatgtctgggatatct 100  Q
    ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||    
T  32248609 catgtccgggacgtcttggatcccattctctttctttctgactatgtccgggacgtcttgggtctcgttctctttcttcctggctatgtctgggatatct 32248708  T
Q  101 tgtttcccattgttcttcctcactaggtttctgatgccctggtctacgaatgtgtcttggtctccgttcatcttcttcctcctcgtgacttctttcgtat 200  Q
    ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||    
T  32248709 tgtttcccattgttcttcctcactaggtttctgatgccctggtctacgaatgtgtcttggtctccgttcatcttcttcctcctcgtgacttctttcgtat 32248808  T
Q  201 tcttcatct 209  Q
    |||||||||    
T  32248809 tcttcatct 32248817  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr1; HSP #2
Raw Score: 204; E-Value: 1e-111
Query Start/End: Original strand, 2 - 209
Target Start/End: Original strand, 32242872 - 32243079
Alignment:
Q  2 atgtccgggacgtcttggatcccattctctttctttctgactatgtccgggacgtcttgggtctcgttctctttcttcctggctatgtctgggatatctt 101  Q
    |||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||    
T  32242872 atgtccgggatgtcttggatcccattctctttctttctgactatgtccgggacgtcttgggtctcgttctctttcttcctggctatgtctgggatatctt 32242971  T
Q  102 gtttcccattgttcttcctcactaggtttctgatgccctggtctacgaatgtgtcttggtctccgttcatcttcttcctcctcgtgacttctttcgtatt 201  Q
    ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||    
T  32242972 gtttcccattgttcttcctcactaggtttctgatgccctggtctacgaatgtgtcttggtctccgttcatcttcttcctcctcgtgacttctttcgtatt 32243071  T
Q  202 cttcatct 209  Q
    ||||||||    
T  32243072 cttcatct 32243079  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr1; HSP #3
Raw Score: 61; E-Value: 2e-26
Query Start/End: Original strand, 27 - 111
Target Start/End: Original strand, 32242813 - 32242897
Alignment:
Q  27 tctctttctttctgactatgtccgggacgtcttgggtctcgttctctttcttcctggctatgtctgggatatcttgtttcccatt 111  Q
    |||||||||| |||||||||||||||||||||||||||||| |||||||||||||||||||||| ||||| |||||  |||||||    
T  32242813 tctctttcttcctgactatgtccgggacgtcttgggtctcgctctctttcttcctggctatgtccgggatgtcttggatcccatt 32242897  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr1; HSP #4
Raw Score: 60; E-Value: 9e-26
Query Start/End: Original strand, 2 - 89
Target Start/End: Original strand, 32253444 - 32253531
Alignment:
Q  2 atgtccgggacgtcttggatcccattctctttctttctgactatgtccgggacgtcttgggtctcgttctctttcttcctggctatgt 89  Q
    |||||||||| |||||||||||||||||||||||| |||||||||||||||| |||||||||| || ||||||||||| || ||||||    
T  32253444 atgtccgggatgtcttggatcccattctctttcttcctgactatgtccgggatgtcttgggtcccgctctctttcttcttgactatgt 32253531  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr1; HSP #5
Raw Score: 53; E-Value: 1e-21
Query Start/End: Original strand, 27 - 111
Target Start/End: Original strand, 32253385 - 32253469
Alignment:
Q  27 tctctttctttctgactatgtccgggacgtcttgggtctcgttctctttcttcctggctatgtctgggatatcttgtttcccatt 111  Q
    |||||||||| ||||||||||| |||| ||||||||||||| |||||||||||||||||||||| ||||| |||||  |||||||    
T  32253385 tctctttcttcctgactatgtctgggatgtcttgggtctcgctctctttcttcctggctatgtccgggatgtcttggatcccatt 32253469  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr1; HSP #6
Raw Score: 45; E-Value: 8e-17
Query Start/End: Original strand, 2 - 209
Target Start/End: Original strand, 32253402 - 32253603
Alignment:
Q  2 atgtccgggacgtcttggatcccattctctttctttctgactatgtccgggacgtcttgggtctcgttctctttcttcctggctatgtctgggatatctt 101  Q
    ||||| |||| ||||||| || |  |||||||||| ||| |||||||||||| ||||||| || | ||||||||||||||| ||||||| ||||| ||||    
T  32253402 atgtctgggatgtcttgggtctcgctctctttcttcctggctatgtccgggatgtcttggatcccattctctttcttcctgactatgtccgggatgtctt 32253501  T
Q  102 gtttcccattgt---tcttcctcactaggtttctgatgccctggtctacgaatgtgtcttggtctccgttcatcttcttcctcctcgtgacttctttcgt 198  Q
    |  ||||  | |   ||||| | |||| |||         || ||||| ||| |||||||| ||||| ||||||||||||||||||| |||||||||| |    
T  32253502 gggtcccgctctctttcttcttgactatgtt---------ctcgtctaagaaggtgtcttgatctcccttcatcttcttcctcctcgggacttctttcat 32253592  T
Q  199 attcttcatct 209  Q
    |||||||||||    
T  32253593 attcttcatct 32253603  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr1; HSP #7
Raw Score: 42; E-Value: 0.000000000000005
Query Start/End: Original strand, 2 - 95
Target Start/End: Original strand, 32242830 - 32242923
Alignment:
Q  2 atgtccgggacgtcttggatcccattctctttctttctgactatgtccgggacgtcttgggtctcgttctctttcttcctggctatgtctggga 95  Q
    |||||||||||||||||| || |  |||||||||| ||| |||||||||||| ||||||| || | ||||||||||| ||| ||||||| ||||    
T  32242830 atgtccgggacgtcttgggtctcgctctctttcttcctggctatgtccgggatgtcttggatcccattctctttctttctgactatgtccggga 32242923  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr1; HSP #8
Raw Score: 35; E-Value: 0.00000000008
Query Start/End: Original strand, 13 - 95
Target Start/End: Original strand, 32248579 - 32248661
Alignment:
Q  13 gtcttggatcccattctctttctttctgactatgtccgggacgtcttgggtctcgttctctttcttcctggctatgtctggga 95  Q
    ||||||| || | ||||||||||| ||| | |||||||||||||||||| || | ||||||||||| ||| ||||||| ||||    
T  32248579 gtcttgggtctcgttctctttcttcctggccatgtccgggacgtcttggatcccattctctttctttctgactatgtccggga 32248661  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Oklahoma State University