View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF8226_low_34 (Length: 327)
Name: NF8226_low_34
Description: NF8226
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF8226_low_34 |
 | |
|
Alignment Details
Target: chr1 (Bit Score: 115; Significance: 2e-58; HSPs: 3)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 115; E-Value: 2e-58
Query Start/End: Original strand, 18 - 132
Target Start/End: Original strand, 46919865 - 46919979
Alignment:
| Q |
18 |
aatcacacaaagaccatttgacaatatgtctttaccaaacacttttagatataaagatttttgacttgtaagtgtttcaaccttcaattttctatcaatt |
117 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
46919865 |
aatcacacaaagaccatttgacaatatgtctttaccaaacacttttagatataaagatttttgacttgtaagtgtttcaaccttcaattttctatcaatt |
46919964 |
T |
|
| Q |
118 |
gcgacactttgttca |
132 |
Q |
| |
|
||||||||||||||| |
|
|
| T |
46919965 |
gcgacactttgttca |
46919979 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #2
Raw Score: 93; E-Value: 3e-45
Query Start/End: Original strand, 154 - 307
Target Start/End: Original strand, 46920168 - 46920321
Alignment:
| Q |
154 |
ttataacctatgtgagttaaatcacacaaggtttataacgagcgtaagttagtttacgcaacgtgacttaagtctcgca-ggtatttttagaagtttggt |
252 |
Q |
| |
|
|||||||||||||||||||| ||||||||||||||||||||||||| |||| ||||||||| ||||||||||||||||| |||||||||||||||||||| |
|
|
| T |
46920168 |
ttataacctatgtgagttaactcacacaaggtttataacgagcgtatgttaatttacgcaaagtgacttaagtctcgcagggtatttttagaagtttggt |
46920267 |
T |
|
| Q |
253 |
tatgagcgaacaannnnnnnatcgagaagagcatactttctcaatttagctcctc |
307 |
Q |
| |
|
|| |||||||||| ||| ||||||||||| ||||||||||||||||||| |
|
|
| T |
46920268 |
taggagcgaacaa-ttttttatcaagaagagcataatttctcaatttagctcctc |
46920321 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #3
Raw Score: 30; E-Value: 0.0000001
Query Start/End: Original strand, 160 - 262
Target Start/End: Original strand, 46150397 - 46150501
Alignment:
| Q |
160 |
cctatgtgagttaaatcacacaaggtttataacgagcgtaagttagtttacgcaacgtgacttaagtctcgca--ggtatttttagaagtttggttatga |
257 |
Q |
| |
|
|||| ||||||||| |||| |||| |||||||| |||| ||||| | ||||| |||||||||||| |||| |||||||||| |||||||||| || |
|
|
| T |
46150397 |
cctacgtgagttaattcacgcaagatttataacatgcgtgagttaactcacgcagcgtgacttaagtgacgcattggtatttttaaaagtttggttggga |
46150496 |
T |
|
| Q |
258 |
gcgaa |
262 |
Q |
| |
|
||||| |
|
|
| T |
46150497 |
gcgaa |
46150501 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University