View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF8226_low_43 (Length: 264)
Name: NF8226_low_43
Description: NF8226
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF8226_low_43 |
 | |
|
Alignment Details
Target: chr8 (Bit Score: 153; Significance: 4e-81; HSPs: 1)
Name: chr8
Description:
Target: chr8; HSP #1
Raw Score: 153; E-Value: 4e-81
Query Start/End: Original strand, 8 - 248
Target Start/End: Original strand, 430078 - 430317
Alignment:
| Q |
8 |
ttggtggtggtggtgactagtctttccatcacatgtgtgttgttggaattattccaacaccatttt-ctctcctacctttccttaaacacacgtgaaaca |
106 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||| |||||| |
|
|
| T |
430078 |
ttggtggtggtggtgactagtctttccatcacatgtgtgttgttggaattattccaacaccatttttctctcctacctttccttaaacacacgggaaaca |
430177 |
T |
|
| Q |
107 |
tgtttgtgattgctctctagaatgtccaagttcaacaaaatcttttattctccggtctcnnnnnnnnnnnnnnnnnnnngattttatagttcaagttcaa |
206 |
Q |
| |
|
|||||| ||||||||||| |||||||||||||||||||||||||||||||||||||||| ||||||||||||||||| ||| |
|
|
| T |
430178 |
tgtttgcgattgctctctcgaatgtccaagttcaacaaaatcttttattctccggtctc--ataaaaaaaaaaaaaaaagattttatagttcaagtacaa |
430275 |
T |
|
| Q |
207 |
tggaatttcaatttctcttttatgaaagtaactctgaaggtg |
248 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
430276 |
tggaatttcaatttctcttttatgaaagtaactctgaaggtg |
430317 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University