View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF8226_low_44 (Length: 262)
Name: NF8226_low_44
Description: NF8226
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF8226_low_44 |
 | |
|
Alignment Details
Target: chr7 (Bit Score: 71; Significance: 3e-32; HSPs: 2)
Name: chr7
Description:
Target: chr7; HSP #1
Raw Score: 71; E-Value: 3e-32
Query Start/End: Original strand, 177 - 251
Target Start/End: Complemental strand, 814199 - 814125
Alignment:
| Q |
177 |
cgagtcctcgaggatatggaggttagttcaaagaattcgtggattgcttgtgatggagtgaaaagtaacattctt |
251 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||| |
|
|
| T |
814199 |
cgagtcctcgaggatatggaggttagttcaaagaattcgtcgattgcttgtgatggagtgaaaagtaacattctt |
814125 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #2
Raw Score: 33; E-Value: 0.000000001
Query Start/End: Original strand, 17 - 49
Target Start/End: Complemental strand, 814353 - 814321
Alignment:
| Q |
17 |
atcatgtcgtaactattattataacaacttcag |
49 |
Q |
| |
|
||||||||||||||||||||||||||||||||| |
|
|
| T |
814353 |
atcatgtcgtaactattattataacaacttcag |
814321 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University