View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF8226_low_52 (Length: 251)
Name: NF8226_low_52
Description: NF8226
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF8226_low_52 |
 | |
|
Alignment Details
Target: chr3 (Bit Score: 216; Significance: 1e-119; HSPs: 1)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 216; E-Value: 1e-119
Query Start/End: Original strand, 15 - 234
Target Start/End: Complemental strand, 44344014 - 44343795
Alignment:
| Q |
15 |
agcaccacaaactccaggcataaaagcaaaccagcgatcagaagcaccttctgcaggtggaatgatgggttcattacgtgtaatagagcttcaacttgta |
114 |
Q |
| |
|
|||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
44344014 |
agcaccacaaactccaggcacaaaagcaaaccagcgatcagaagcaccttctgcaggtggaatgatgggttcattacgtgtaatagagcttcaacttgta |
44343915 |
T |
|
| Q |
115 |
gcattcatattagttttctcagcaagtggtcttgttcctcttcttgatctagtttttccagctcttgcctctgcatacatcttagcacttgcacgttacg |
214 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
44343914 |
gcattcatattagttttctcagcaagtggtcttgttcctcttcttgatctagtttttccagctcttgcctctgcatacatcttagcacttgcacgttacg |
44343815 |
T |
|
| Q |
215 |
catttccatcatctccttct |
234 |
Q |
| |
|
|||||||||||||||||||| |
|
|
| T |
44343814 |
catttccatcatctccttct |
44343795 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8 (Bit Score: 63; Significance: 2e-27; HSPs: 1)
Name: chr8
Description:
Target: chr8; HSP #1
Raw Score: 63; E-Value: 2e-27
Query Start/End: Original strand, 75 - 165
Target Start/End: Complemental strand, 39475241 - 39475151
Alignment:
| Q |
75 |
aatgatgggttcattacgtgtaatagagcttcaacttgtagcattcatattagttttctcagcaagtggtcttgttcctcttcttgatcta |
165 |
Q |
| |
|
||||||||||||||||||||||||||| || ||||||||||| || |||| ||||||||||||||||||||||| ||||||||||||||| |
|
|
| T |
39475241 |
aatgatgggttcattacgtgtaatagaactacaacttgtagcctttgtattggttttctcagcaagtggtcttgtccctcttcttgatcta |
39475151 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University