View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF8226_low_53 (Length: 245)
Name: NF8226_low_53
Description: NF8226
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF8226_low_53 |
 |  |
|
| [»] chr8 (1 HSPs) |
 |  |
|
Alignment Details
Target: chr8 (Bit Score: 166; Significance: 6e-89; HSPs: 1)
Name: chr8
Description:
Target: chr8; HSP #1
Raw Score: 166; E-Value: 6e-89
Query Start/End: Original strand, 20 - 245
Target Start/End: Original strand, 16329499 - 16329724
Alignment:
| Q |
20 |
atcagaaaccataaaacatatcagatagtcgaaaattttaaaaattccgtgtgctcagtgtgtgagaacagaagaccaaaatttgaattgatgaaagaat |
119 |
Q |
| |
|
||||||||||||||||| |||||||| || ||||||||||||||||| || |||||||||||||| |||||||| ||||||||||||||||||||||||| |
|
|
| T |
16329499 |
atcagaaaccataaaacgtatcagatcgttgaaaattttaaaaattctgtttgctcagtgtgtgataacagaaggccaaaatttgaattgatgaaagaat |
16329598 |
T |
 |
| Q |
120 |
tcacatatggggagctgcatgaagcaacgcatggtttttcgccaaagaactatttgtcagaaggtggatttggttccgtttattggggaaagatgcaagg |
219 |
Q |
| |
|
||||||| |||||||||||||||||||| ||||||||||| || |||||||||||||||||||| ||||| ||||| ||||||||||||||||||||||| |
|
|
| T |
16329599 |
tcacatacggggagctgcatgaagcaacacatggtttttctcccaagaactatttgtcagaaggcggattcggttcggtttattggggaaagatgcaagg |
16329698 |
T |
 |
| Q |
220 |
acttaagattgctgttaagaaacata |
245 |
Q |
| |
|
||| |||||||||||||||||||||| |
|
|
| T |
16329699 |
actcaagattgctgttaagaaacata |
16329724 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University