View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF8226_low_58 (Length: 230)
Name: NF8226_low_58
Description: NF8226
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF8226_low_58 |
 |  |
|
Alignment Details
Target: chr6 (Bit Score: 107; Significance: 9e-54; HSPs: 2)
Name: chr6
Description:
Target: chr6; HSP #1
Raw Score: 107; E-Value: 9e-54
Query Start/End: Original strand, 105 - 215
Target Start/End: Complemental strand, 1322280 - 1322170
Alignment:
| Q |
105 |
acaataggtctcaatgtaacttttttaatagaagttttggtaggggacaaagaagagagactaaagccgtttatggaagaggtagacattgtgacaatga |
204 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
1322280 |
acaataggtctcaatgtaacttttttaatagaagtttttgtaggggacaaagaagagagactaaagccgtttatggaagaggtagacattgtgacaatga |
1322181 |
T |
 |
| Q |
205 |
agactcaaatc |
215 |
Q |
| |
|
||||||||||| |
|
|
| T |
1322180 |
agactcaaatc |
1322170 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #2
Raw Score: 33; E-Value: 0.000000001
Query Start/End: Original strand, 10 - 46
Target Start/End: Complemental strand, 1322375 - 1322339
Alignment:
| Q |
10 |
gagatgaagatgaagcaaaaacaggcttgtcttgaat |
46 |
Q |
| |
|
|||| |||||||||||||||||||||||||||||||| |
|
|
| T |
1322375 |
gagaagaagatgaagcaaaaacaggcttgtcttgaat |
1322339 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University