View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF8226_low_61 (Length: 218)
Name: NF8226_low_61
Description: NF8226
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF8226_low_61 |
 |  |
|
Alignment Details
Target: chr1 (Bit Score: 209; Significance: 1e-114; HSPs: 8)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 209; E-Value: 1e-114
Query Start/End: Original strand, 1 - 209
Target Start/End: Original strand, 32248609 - 32248817
Alignment:
| Q |
1 |
catgtccgggacgtcttggatcccattctctttctttctgactatgtccgggacgtcttgggtctcgttctctttcttcctggctatgtctgggatatct |
100 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
32248609 |
catgtccgggacgtcttggatcccattctctttctttctgactatgtccgggacgtcttgggtctcgttctctttcttcctggctatgtctgggatatct |
32248708 |
T |
 |
| Q |
101 |
tgtttcccattgttcttcctcactaggtttctgatgccctggtctacgaatgtgtcttggtctccgttcatcttcttcctcctcgtgacttctttcgtat |
200 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
32248709 |
tgtttcccattgttcttcctcactaggtttctgatgccctggtctacgaatgtgtcttggtctccgttcatcttcttcctcctcgtgacttctttcgtat |
32248808 |
T |
 |
| Q |
201 |
tcttcatct |
209 |
Q |
| |
|
||||||||| |
|
|
| T |
32248809 |
tcttcatct |
32248817 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #2
Raw Score: 204; E-Value: 1e-111
Query Start/End: Original strand, 2 - 209
Target Start/End: Original strand, 32242872 - 32243079
Alignment:
| Q |
2 |
atgtccgggacgtcttggatcccattctctttctttctgactatgtccgggacgtcttgggtctcgttctctttcttcctggctatgtctgggatatctt |
101 |
Q |
| |
|
|||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
32242872 |
atgtccgggatgtcttggatcccattctctttctttctgactatgtccgggacgtcttgggtctcgttctctttcttcctggctatgtctgggatatctt |
32242971 |
T |
 |
| Q |
102 |
gtttcccattgttcttcctcactaggtttctgatgccctggtctacgaatgtgtcttggtctccgttcatcttcttcctcctcgtgacttctttcgtatt |
201 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
32242972 |
gtttcccattgttcttcctcactaggtttctgatgccctggtctacgaatgtgtcttggtctccgttcatcttcttcctcctcgtgacttctttcgtatt |
32243071 |
T |
 |
| Q |
202 |
cttcatct |
209 |
Q |
| |
|
|||||||| |
|
|
| T |
32243072 |
cttcatct |
32243079 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #3
Raw Score: 61; E-Value: 2e-26
Query Start/End: Original strand, 27 - 111
Target Start/End: Original strand, 32242813 - 32242897
Alignment:
| Q |
27 |
tctctttctttctgactatgtccgggacgtcttgggtctcgttctctttcttcctggctatgtctgggatatcttgtttcccatt |
111 |
Q |
| |
|
|||||||||| |||||||||||||||||||||||||||||| |||||||||||||||||||||| ||||| ||||| ||||||| |
|
|
| T |
32242813 |
tctctttcttcctgactatgtccgggacgtcttgggtctcgctctctttcttcctggctatgtccgggatgtcttggatcccatt |
32242897 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #4
Raw Score: 60; E-Value: 9e-26
Query Start/End: Original strand, 2 - 89
Target Start/End: Original strand, 32253444 - 32253531
Alignment:
| Q |
2 |
atgtccgggacgtcttggatcccattctctttctttctgactatgtccgggacgtcttgggtctcgttctctttcttcctggctatgt |
89 |
Q |
| |
|
|||||||||| |||||||||||||||||||||||| |||||||||||||||| |||||||||| || ||||||||||| || |||||| |
|
|
| T |
32253444 |
atgtccgggatgtcttggatcccattctctttcttcctgactatgtccgggatgtcttgggtcccgctctctttcttcttgactatgt |
32253531 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #5
Raw Score: 53; E-Value: 1e-21
Query Start/End: Original strand, 27 - 111
Target Start/End: Original strand, 32253385 - 32253469
Alignment:
| Q |
27 |
tctctttctttctgactatgtccgggacgtcttgggtctcgttctctttcttcctggctatgtctgggatatcttgtttcccatt |
111 |
Q |
| |
|
|||||||||| ||||||||||| |||| ||||||||||||| |||||||||||||||||||||| ||||| ||||| ||||||| |
|
|
| T |
32253385 |
tctctttcttcctgactatgtctgggatgtcttgggtctcgctctctttcttcctggctatgtccgggatgtcttggatcccatt |
32253469 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #6
Raw Score: 45; E-Value: 8e-17
Query Start/End: Original strand, 2 - 209
Target Start/End: Original strand, 32253402 - 32253603
Alignment:
| Q |
2 |
atgtccgggacgtcttggatcccattctctttctttctgactatgtccgggacgtcttgggtctcgttctctttcttcctggctatgtctgggatatctt |
101 |
Q |
| |
|
||||| |||| ||||||| || | |||||||||| ||| |||||||||||| ||||||| || | ||||||||||||||| ||||||| ||||| |||| |
|
|
| T |
32253402 |
atgtctgggatgtcttgggtctcgctctctttcttcctggctatgtccgggatgtcttggatcccattctctttcttcctgactatgtccgggatgtctt |
32253501 |
T |
 |
| Q |
102 |
gtttcccattgt---tcttcctcactaggtttctgatgccctggtctacgaatgtgtcttggtctccgttcatcttcttcctcctcgtgacttctttcgt |
198 |
Q |
| |
|
| |||| | | ||||| | |||| ||| || ||||| ||| |||||||| ||||| ||||||||||||||||||| |||||||||| | |
|
|
| T |
32253502 |
gggtcccgctctctttcttcttgactatgtt---------ctcgtctaagaaggtgtcttgatctcccttcatcttcttcctcctcgggacttctttcat |
32253592 |
T |
 |
| Q |
199 |
attcttcatct |
209 |
Q |
| |
|
||||||||||| |
|
|
| T |
32253593 |
attcttcatct |
32253603 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #7
Raw Score: 42; E-Value: 0.000000000000005
Query Start/End: Original strand, 2 - 95
Target Start/End: Original strand, 32242830 - 32242923
Alignment:
| Q |
2 |
atgtccgggacgtcttggatcccattctctttctttctgactatgtccgggacgtcttgggtctcgttctctttcttcctggctatgtctggga |
95 |
Q |
| |
|
|||||||||||||||||| || | |||||||||| ||| |||||||||||| ||||||| || | ||||||||||| ||| ||||||| |||| |
|
|
| T |
32242830 |
atgtccgggacgtcttgggtctcgctctctttcttcctggctatgtccgggatgtcttggatcccattctctttctttctgactatgtccggga |
32242923 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #8
Raw Score: 35; E-Value: 0.00000000008
Query Start/End: Original strand, 13 - 95
Target Start/End: Original strand, 32248579 - 32248661
Alignment:
| Q |
13 |
gtcttggatcccattctctttctttctgactatgtccgggacgtcttgggtctcgttctctttcttcctggctatgtctggga |
95 |
Q |
| |
|
||||||| || | ||||||||||| ||| | |||||||||||||||||| || | ||||||||||| ||| ||||||| |||| |
|
|
| T |
32248579 |
gtcttgggtctcgttctctttcttcctggccatgtccgggacgtcttggatcccattctctttctttctgactatgtccggga |
32248661 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University