View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF8226_low_62 (Length: 212)
Name: NF8226_low_62
Description: NF8226
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF8226_low_62 |
 |  |
|
Alignment Details
Target: chr2 (Bit Score: 159; Significance: 7e-85; HSPs: 1)
Name: chr2
Description:
Target: chr2; HSP #1
Raw Score: 159; E-Value: 7e-85
Query Start/End: Original strand, 18 - 196
Target Start/End: Complemental strand, 13714314 - 13714136
Alignment:
| Q |
18 |
gttatagatgctatgttgttagagttagctaaagttcatactgataataatggctataatatgatgactaaaacactaccaagagaacagtttcaaacta |
117 |
Q |
| |
|
||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||| |||||| |
|
|
| T |
13714314 |
gttatagatgctatgttgttagagttagctaaatttcatactgataataatggctataatatgatgactaaaacactaccaagagaaaagtttgaaacta |
13714215 |
T |
 |
| Q |
118 |
tcagtagtttggattgattacctccacatagttgtgagagggagatgagatatgctgggtattggggtccttctcaatg |
196 |
Q |
| |
|
||| |||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||| |
|
|
| T |
13714214 |
tcactagtttggattgattacctccacatagttgtgagagggagattagatatgctgggtattggggtccttctcaatg |
13714136 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6 (Bit Score: 30; Significance: 0.00000007; HSPs: 1)
Name: chr6
Description:
Target: chr6; HSP #1
Raw Score: 30; E-Value: 0.00000007
Query Start/End: Original strand, 24 - 89
Target Start/End: Original strand, 6856753 - 6856818
Alignment:
| Q |
24 |
gatgctatgttgttagagttagctaaagttcatactgataataatggctataatatgatgactaaa |
89 |
Q |
| |
|
||||||| |||||| |||||| |||||||||||| |||| ||| | | ||| |||||||||||||| |
|
|
| T |
6856753 |
gatgctaagttgttggagttatctaaagttcatattgattatagtagttatgatatgatgactaaa |
6856818 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University