View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF8227_high_6 (Length: 242)
Name: NF8227_high_6
Description: NF8227
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF8227_high_6 |
 | |
|
Alignment Details
Target: chr7 (Bit Score: 214; Significance: 1e-117; HSPs: 1)
Name: chr7
Description:
Target: chr7; HSP #1
Raw Score: 214; E-Value: 1e-117
Query Start/End: Original strand, 5 - 234
Target Start/End: Original strand, 24098947 - 24099176
Alignment:
| Q |
5 |
ttttaccctatagtcttaatttatgcaaacaagtaagtaaaattgtacaaagtggtgaccaccaaaccaagcatagcatagcacaactcaccatcaatac |
104 |
Q |
| |
|
||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||| |
|
|
| T |
24098947 |
ttttaccctatggtcttaatttatgcaaacaagtaagtaaaattgtacaaagtggtgaccaccaaaccaagcatagcatagcacaactcaacatcaatag |
24099046 |
T |
|
| Q |
105 |
ttgaatgcaaaccaagaaaggtcgttctcttgccttgcagattggagtgaatctgaattgtgtcaatgcctcaatggtgctatctacttgatgtccaagc |
204 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
24099047 |
ttgaatgcaaaccaagaaaggtcgttctcttgccttgcagatttgagtgaatctgaattgtgtcaatgcctcaatggtgctatctacttgatgtccaagc |
24099146 |
T |
|
| Q |
205 |
tacacatgagattgtaatatatgatgtcca |
234 |
Q |
| |
|
|||||||||||||||||||||||||||||| |
|
|
| T |
24099147 |
tacacatgagattgtaatatatgatgtcca |
24099176 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University