View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF8227_low_1 (Length: 623)
Name: NF8227_low_1
Description: NF8227
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF8227_low_1 |
 |  |
|
Alignment Details
Target: chr7 (Bit Score: 150; Significance: 5e-79; HSPs: 5)
Name: chr7
Description:
Target: chr7; HSP #1
Raw Score: 150; E-Value: 5e-79
Query Start/End: Original strand, 446 - 607
Target Start/End: Original strand, 28290590 - 28290751
Alignment:
| Q |
446 |
ataataaatgcaattagtatactttactgaatccaaaaatgatgttttgtcaggatttatttgctgctgggattgacacaacttcaagcacaattgaatg |
545 |
Q |
| |
|
|||||||||||||||||||||| |||||||||||| |||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
28290590 |
ataataaatgcaattagtatacattactgaatccagaaatgatgttttgttaggatttatttgctgctgggattgacacaacttcaagcacaattgaatg |
28290689 |
T |
 |
| Q |
546 |
gatcatggtagagctactacgcaaccctagcaatatgacaaaagcaagaacagaattatcta |
607 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
28290690 |
gatcatggtagagctactacgcaaccctagcaatatgacaaaagcaagaacagaattatcta |
28290751 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #2
Raw Score: 49; E-Value: 1e-18
Query Start/End: Original strand, 482 - 566
Target Start/End: Complemental strand, 28320173 - 28320089
Alignment:
| Q |
482 |
aaatgatgttttgtcaggatttatttgctgctgggattgacacaacttcaagcacaattgaatggatcatggtagagctactacg |
566 |
Q |
| |
|
|||| ||||||||| |||| ||||||| |||||||||||||||||| ||||||| |||||||||||| || | |||||||||||| |
|
|
| T |
28320173 |
aaatcatgttttgttaggacttatttgttgctgggattgacacaacatcaagcataattgaatggattattgcagagctactacg |
28320089 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #3
Raw Score: 41; E-Value: 0.00000000000006
Query Start/End: Original strand, 490 - 578
Target Start/End: Complemental strand, 28329011 - 28328923
Alignment:
| Q |
490 |
ttttgtcaggatttatttgctgctgggattgacacaacttcaagcacaattgaatggatcatggtagagctactacgcaaccctagcaa |
578 |
Q |
| |
|
||||| |||||||||||| |||||||||||||||||| |||| ||| |||||||||| |||| ||||||| |||| |||||| |||| |
|
|
| T |
28329011 |
ttttggcaggatttattttttgctgggattgacacaacatcaaacacgattgaatggactatggcagagctattacgtaaccctggcaa |
28328923 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #4
Raw Score: 37; E-Value: 0.00000000001
Query Start/End: Original strand, 497 - 573
Target Start/End: Complemental strand, 28296325 - 28296249
Alignment:
| Q |
497 |
aggatttatttgctgctgggattgacacaacttcaagcacaattgaatggatcatggtagagctactacgcaaccct |
573 |
Q |
| |
|
||||||| |||| |||||| ||||||||||| |||||||| ||||||||||| |||| |||||| |||| |||||| |
|
|
| T |
28296325 |
aggatttgtttgttgctggtattgacacaacatcaagcacgattgaatggattatggcggagctattacgtaaccct |
28296249 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #5
Raw Score: 29; E-Value: 0.0000009
Query Start/End: Original strand, 488 - 564
Target Start/End: Complemental strand, 28303510 - 28303434
Alignment:
| Q |
488 |
tgttttgtcaggatttatttgctgctgggattgacacaacttcaagcacaattgaatggatcatggtagagctacta |
564 |
Q |
| |
|
|||||||| | |||||||||| ||| |||||||||||| | ||||| || ||||| ||| | |||| |||||||||| |
|
|
| T |
28303510 |
tgttttgttatgatttatttgttgccgggattgacacatcatcaaggacgattgagtgggttatggcagagctacta |
28303434 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University