View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF8227_low_7 (Length: 234)
Name: NF8227_low_7
Description: NF8227
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF8227_low_7 |
 | |
|
Alignment Details
Target: chr2 (Bit Score: 165; Significance: 2e-88; HSPs: 1)
Name: chr2
Description:
Target: chr2; HSP #1
Raw Score: 165; E-Value: 2e-88
Query Start/End: Original strand, 49 - 220
Target Start/End: Complemental strand, 44676881 - 44676709
Alignment:
| Q |
49 |
cttgtcactaa-gtcttctcattgtctcgtctttgttcccctctcatttgtgacttcccaaatgctaaattcctcctattcatttttggtaatatactgc |
147 |
Q |
| |
|
||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
44676881 |
cttgtcactaaagtcttctcattgtctcgtctttgttcccctctcatttgtgacttcccaaatgctaaattcctcctattcatttttggtaatatactgc |
44676782 |
T |
|
| Q |
148 |
tatgattattctctatttactcattctcaccccttttgtttctttctttttcttggtcaacattcttcatctc |
220 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
44676781 |
tatgattattctctatttactcattctcaccccttttgtttctttctttttcttggtcaacattcttcatctc |
44676709 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University