View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF8228_high_32 (Length: 246)
Name: NF8228_high_32
Description: NF8228
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF8228_high_32 |
 |  |
|
Alignment Details
Target: chr1 (Bit Score: 196; Significance: 1e-107; HSPs: 1)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 196; E-Value: 1e-107
Query Start/End: Original strand, 18 - 241
Target Start/End: Original strand, 10344058 - 10344280
Alignment:
| Q |
18 |
agcttttactactttgatgagtcggttattgaaaacataatcttttaggatcacctctaggccaaaattgtttatatcctaattagtgtgaaactggcaa |
117 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||| |
|
|
| T |
10344058 |
agcttttactactttgatgagtcggttattgaaaacataatcttttaggatcacctctaggccaaaattgtttatatcctaattagtgtgaaac-ggcaa |
10344156 |
T |
 |
| Q |
118 |
ttaatcttacttttatttttagtagtagcagttctagtaagttacgtgattgcattgatcagttaagaaaagtttgaaagaaaaggtgggaagctgatgt |
217 |
Q |
| |
|
||||||||||||| |||||||||| |||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||| |
|
|
| T |
10344157 |
ttaatcttactttcatttttagtattagcagttctagtaagttacgtgattgcattgatcagttaagaagagtttgaaagaaaaggtgggaagctgatgt |
10344256 |
T |
 |
| Q |
218 |
gttgtaatgttgcttcttctcact |
241 |
Q |
| |
|
||||||||||||||| || ||||| |
|
|
| T |
10344257 |
gttgtaatgttgcttgttatcact |
10344280 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University