View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF8228_high_40 (Length: 209)
Name: NF8228_high_40
Description: NF8228
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF8228_high_40 |
 |  |
|
| [»] chr7 (1 HSPs) |
 |  |
|
Alignment Details
Target: chr7 (Bit Score: 201; Significance: 1e-110; HSPs: 1)
Name: chr7
Description:
Target: chr7; HSP #1
Raw Score: 201; E-Value: 1e-110
Query Start/End: Original strand, 1 - 209
Target Start/End: Original strand, 38932025 - 38932233
Alignment:
| Q |
1 |
atgaatcatttatatataacaaagttggttgcatttaggagtaattgttagattataattaatgttgcttactcttgggatacgatcgagttggtttagt |
100 |
Q |
| |
|
|||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
38932025 |
atgaatgatttatatataacaaagttggttgcatttaggagtaattgttagattataattaatgttgcttactcttgggatacgatcgagttggtttagt |
38932124 |
T |
 |
| Q |
101 |
ttattggaagtgtcgaggagagtgacaataataagcggggtattgccgtaattgtaggtccagtaaggaacaccaggtggaatagcaataaggtcaccct |
200 |
Q |
| |
|
||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
38932125 |
ttattggaagtgtcgaggagagtgacaataataagaggggtattgccgtaattgtaggtccagtaaggaacaccaggtggaatagcaataaggtcaccct |
38932224 |
T |
 |
| Q |
201 |
gtttcacat |
209 |
Q |
| |
|
||||||||| |
|
|
| T |
38932225 |
gtttcacat |
38932233 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University