View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF8228_low_17 (Length: 368)
Name: NF8228_low_17
Description: NF8228
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF8228_low_17 |
 |  |
|
| [»] scaffold0045 (1 HSPs) |
 |  |  |
|
| [»] scaffold0209 (1 HSPs) |
 |  |  |
|
Alignment Details
Target: chr3 (Bit Score: 63; Significance: 3e-27; HSPs: 4)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 63; E-Value: 3e-27
Query Start/End: Original strand, 61 - 202
Target Start/End: Complemental strand, 28538263 - 28538122
Alignment:
| Q |
61 |
ttgaccagtgtgcatacctctacgcttgagtcaaattagtcgcccgttattagtggattgaaaaccgatgcaaaagtcaacnnnnnnnnnnnnnctataa |
160 |
Q |
| |
|
||||| ||||||||| |||||||| |||||| |||||||||||||||||||||||||||||||||| |||||||| || |||||| |
|
|
| T |
28538263 |
ttgactagtgtgcatgtctctacgcatgagtcgaattagtcgcccgttattagtggattgaaaaccggtgcaaaagaaaagaaaaaaaaaaaaactataa |
28538164 |
T |
 |
| Q |
161 |
actaacggcacaaaaataaactccgtcaccgttaacccccca |
202 |
Q |
| |
|
|||||||||||||||| ||||||||||||||||||||||||| |
|
|
| T |
28538163 |
actaacggcacaaaaaaaaactccgtcaccgttaacccccca |
28538122 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #2
Raw Score: 55; E-Value: 2e-22
Query Start/End: Original strand, 304 - 358
Target Start/End: Complemental strand, 28538021 - 28537967
Alignment:
| Q |
304 |
gatatatgtgattttcaccctcattacattactgggtcagtgttgattttctctg |
358 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
28538021 |
gatatatgtgattttcaccctcattacattactgggtcagtgttgattttctctg |
28537967 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #3
Raw Score: 31; E-Value: 0.00000003
Query Start/End: Original strand, 47 - 85
Target Start/End: Original strand, 4638172 - 4638210
Alignment:
| Q |
47 |
aggagaaacaacgtttgaccagtgtgcatacctctacgc |
85 |
Q |
| |
|
||||||||||||| |||||||||| |||||||||||||| |
|
|
| T |
4638172 |
aggagaaacaacgcttgaccagtgcgcatacctctacgc |
4638210 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #4
Raw Score: 29; E-Value: 0.0000005
Query Start/End: Original strand, 53 - 105
Target Start/End: Original strand, 7648764 - 7648816
Alignment:
| Q |
53 |
aacaacgtttgaccagtgtgcatacctctacgcttgagtcaaattagtcgccc |
105 |
Q |
| |
|
|||||||||||||||||| |||||||||||||| ||| | ||||||||||| |
|
|
| T |
7648764 |
aacaacgtttgaccagtgcgcatacctctacgcacgagccggattagtcgccc |
7648816 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5 (Bit Score: 38; Significance: 0.000000000002; HSPs: 4)
Name: chr5
Description:
Target: chr5; HSP #1
Raw Score: 38; E-Value: 0.000000000002
Query Start/End: Original strand, 53 - 118
Target Start/End: Original strand, 7616945 - 7617010
Alignment:
| Q |
53 |
aacaacgtttgaccagtgtgcatacctctacgcttgagtcaaattagtcgcccgttattagtggat |
118 |
Q |
| |
|
||||||||||||||||| ||||| ||||||||| ||||||| |||||||| || ||||| |||||| |
|
|
| T |
7616945 |
aacaacgtttgaccagtatgcatgcctctacgcatgagtcagattagtcgtccattattggtggat |
7617010 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #2
Raw Score: 35; E-Value: 0.0000000001
Query Start/End: Original strand, 36 - 102
Target Start/End: Complemental strand, 35638132 - 35638066
Alignment:
| Q |
36 |
attcgattataaggagaaacaacgtttgaccagtgtgcatacctctacgcttgagtcaaattagtcg |
102 |
Q |
| |
|
|||||||| | ||||| ||||||||||| |||||||||||||||||||| |||||| |||||||| |
|
|
| T |
35638132 |
attcgattttcaggaggaacaacgtttggtcagtgtgcatacctctacgcacgagtcagattagtcg |
35638066 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #3
Raw Score: 32; E-Value: 0.000000008
Query Start/End: Original strand, 28 - 103
Target Start/End: Original strand, 39728387 - 39728462
Alignment:
| Q |
28 |
aatactagattcgattataaggagaaacaacgtttgaccagtgtgcatacctctacgcttgagtcaaattagtcgc |
103 |
Q |
| |
|
||||| || ||||||||| || |||||||| ||| ||||||||||| |||||||||| ||||| |||||||||| |
|
|
| T |
39728387 |
aataccaggttcgattatcagaggaaacaacacttggccagtgtgcatgcctctacgctcgagtcgaattagtcgc |
39728462 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #4
Raw Score: 29; E-Value: 0.0000005
Query Start/End: Original strand, 28 - 136
Target Start/End: Original strand, 21149734 - 21149842
Alignment:
| Q |
28 |
aatactagattcgattataaggagaaacaacgtttgaccagtgtgcatacctctacgcttgagtcaaattagtcgcccgttattagtggattgaaaaccg |
127 |
Q |
| |
|
||||| || ||||||| | ||| | |||||||||||||||||| |||| |||||||| |||| ||||||||||| ||| |||||| |||||||| |
|
|
| T |
21149734 |
aataccaggttcgattttcagggggaacaacgtttgaccagtgcgcatgactctacgcacgagttggattagtcgcccaccattggtggatagaaaaccg |
21149833 |
T |
 |
| Q |
128 |
atgcaaaag |
136 |
Q |
| |
|
|||| |||| |
|
|
| T |
21149834 |
atgcgaaag |
21149842 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: scaffold0045 (Bit Score: 37; Significance: 0.000000000009; HSPs: 1)
Name: scaffold0045
Description:
Target: scaffold0045; HSP #1
Raw Score: 37; E-Value: 0.000000000009
Query Start/End: Original strand, 28 - 104
Target Start/End: Complemental strand, 58140 - 58064
Alignment:
| Q |
28 |
aatactagattcgattataaggagaaacaacgtttgaccagtgtgcatacctctacgcttgagtcaaattagtcgcc |
104 |
Q |
| |
|
||||||||||| |||| || ||||||||||||||||||||||| |||||||||||| ||||| |||||||||| |
|
|
| T |
58140 |
aatactagatttgattcctagaagaaacaacgtttgaccagtgtgtatacctctacgcatgagttggattagtcgcc |
58064 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6 (Bit Score: 34; Significance: 0.0000000005; HSPs: 3)
Name: chr6
Description:
Target: chr6; HSP #1
Raw Score: 34; E-Value: 0.0000000005
Query Start/End: Original strand, 51 - 100
Target Start/End: Original strand, 11142629 - 11142678
Alignment:
| Q |
51 |
gaaacaacgtttgaccagtgtgcatacctctacgcttgagtcaaattagt |
100 |
Q |
| |
|
|||||||||||||||||||| |||| ||||||||| ||||||| |||||| |
|
|
| T |
11142629 |
gaaacaacgtttgaccagtgcgcatgcctctacgcatgagtcagattagt |
11142678 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #2
Raw Score: 32; E-Value: 0.000000008
Query Start/End: Original strand, 51 - 102
Target Start/End: Original strand, 8888908 - 8888959
Alignment:
| Q |
51 |
gaaacaacgtttgaccagtgtgcatacctctacgcttgagtcaaattagtcg |
102 |
Q |
| |
|
||||||||||||| |||||| |||||||||||||| |||||| |||||||| |
|
|
| T |
8888908 |
gaaacaacgtttggccagtgcgcatacctctacgcatgagtcggattagtcg |
8888959 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #3
Raw Score: 30; E-Value: 0.0000001
Query Start/End: Original strand, 47 - 116
Target Start/End: Complemental strand, 14107446 - 14107377
Alignment:
| Q |
47 |
aggagaaacaacgtttgaccagtgtgcatacctctacgcttgagtcaaattagtcgcccgttattagtgg |
116 |
Q |
| |
|
||||| ||||||| |||||||||| ||| ||||||||| |||| | ||||||||||| |||||||||| |
|
|
| T |
14107446 |
aggaggaacaacgcttgaccagtgcacatgcctctacgcatgagccggattagtcgcccattattagtgg |
14107377 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4 (Bit Score: 32; Significance: 0.000000008; HSPs: 1)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 32; E-Value: 0.000000008
Query Start/End: Original strand, 53 - 140
Target Start/End: Complemental strand, 37369124 - 37369037
Alignment:
| Q |
53 |
aacaacgtttgaccagtgtgcatacctctacgcttgagtcaaattagtcgcccgttattagtggattgaaaaccgatgcaaaagtcaa |
140 |
Q |
| |
|
||||||||||| ||||||||||| ||||||||| ||||| || |||||||| |||| ||| || | |||||||||| |||||||| |
|
|
| T |
37369124 |
aacaacgtttgtccagtgtgcatgcctctacgcacgagtcggataagtcgcccactattggtgaatcggaaaccgatgcgaaagtcaa |
37369037 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1 (Bit Score: 32; Significance: 0.000000008; HSPs: 1)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 32; E-Value: 0.000000008
Query Start/End: Original strand, 47 - 90
Target Start/End: Original strand, 10507717 - 10507760
Alignment:
| Q |
47 |
aggagaaacaacgtttgaccagtgtgcatacctctacgcttgag |
90 |
Q |
| |
|
||||| ||||||||||| ||||||||||||||||||||| |||| |
|
|
| T |
10507717 |
aggaggaacaacgtttggccagtgtgcatacctctacgcatgag |
10507760 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8 (Bit Score: 30; Significance: 0.0000001; HSPs: 3)
Name: chr8
Description:
Target: chr8; HSP #1
Raw Score: 30; E-Value: 0.0000001
Query Start/End: Original strand, 52 - 105
Target Start/End: Original strand, 18091427 - 18091480
Alignment:
| Q |
52 |
aaacaacgtttgaccagtgtgcatacctctacgcttgagtcaaattagtcgccc |
105 |
Q |
| |
|
||||||||||||||||||| |||| ||||||||| ||| | |||||||||||| |
|
|
| T |
18091427 |
aaacaacgtttgaccagtgcgcatgcctctacgcacgaggcgaattagtcgccc |
18091480 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #2
Raw Score: 29; E-Value: 0.0000005
Query Start/End: Original strand, 53 - 105
Target Start/End: Original strand, 583840 - 583892
Alignment:
| Q |
53 |
aacaacgtttgaccagtgtgcatacctctacgcttgagtcaaattagtcgccc |
105 |
Q |
| |
|
||||||| |||||||||| |||| ||||||||| |||||| ||||||||||| |
|
|
| T |
583840 |
aacaacgcttgaccagtgcgcatgcctctacgcatgagtcggattagtcgccc |
583892 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #3
Raw Score: 29; E-Value: 0.0000005
Query Start/End: Original strand, 61 - 105
Target Start/End: Complemental strand, 33401873 - 33401829
Alignment:
| Q |
61 |
ttgaccagtgtgcatacctctacgcttgagtcaaattagtcgccc |
105 |
Q |
| |
|
||||||||||||||| ||||||||| |||||| ||||||||||| |
|
|
| T |
33401873 |
ttgaccagtgtgcatgcctctacgcatgagtcggattagtcgccc |
33401829 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2 (Bit Score: 30; Significance: 0.0000001; HSPs: 2)
Name: chr2
Description:
Target: chr2; HSP #1
Raw Score: 30; E-Value: 0.0000001
Query Start/End: Original strand, 47 - 136
Target Start/End: Original strand, 26805314 - 26805403
Alignment:
| Q |
47 |
aggagaaacaacgtttgaccagtgtgcatacctctacgcttgagtcaaattagtcgcccgttattagtggattgaaaaccgatgcaaaag |
136 |
Q |
| |
|
||||||||| ||||||| |||||| ||| ||||||||| |||||| ||||||||||| || |||| | ||||||||||||||||| |
|
|
| T |
26805314 |
aggagaaacgacgtttggccagtgcacatgcctctacgcatgagtcggattagtcgcccacctttggtggctcgaaaaccgatgcaaaag |
26805403 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #2
Raw Score: 29; E-Value: 0.0000005
Query Start/End: Original strand, 37 - 105
Target Start/End: Original strand, 41187717 - 41187785
Alignment:
| Q |
37 |
ttcgattataaggagaaacaacgtttgaccagtgtgcatacctctacgcttgagtcaaattagtcgccc |
105 |
Q |
| |
|
||||||||| ||| | |||||| ||||||||||| ||| ||||||||| |||| || ||||||||||| |
|
|
| T |
41187717 |
ttcgattatgagggggaacaacacttgaccagtgtccatgcctctacgcatgagacatattagtcgccc |
41187785 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: scaffold0209 (Bit Score: 29; Significance: 0.0000005; HSPs: 1)
Name: scaffold0209
Description:
Target: scaffold0209; HSP #1
Raw Score: 29; E-Value: 0.0000005
Query Start/End: Original strand, 53 - 105
Target Start/End: Original strand, 12600 - 12652
Alignment:
| Q |
53 |
aacaacgtttgaccagtgtgcatacctctacgcttgagtcaaattagtcgccc |
105 |
Q |
| |
|
||||||| |||||||||| |||| ||||||||| |||||| ||||||||||| |
|
|
| T |
12600 |
aacaacgcttgaccagtgcgcatgcctctacgcatgagtcggattagtcgccc |
12652 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University