View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF8228_low_21 (Length: 359)
Name: NF8228_low_21
Description: NF8228
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF8228_low_21 |
 | |
|
Alignment Details
Target: chr1 (Bit Score: 136; Significance: 7e-71; HSPs: 2)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 136; E-Value: 7e-71
Query Start/End: Original strand, 1 - 148
Target Start/End: Complemental strand, 47891745 - 47891599
Alignment:
| Q |
1 |
gagaggagagtagagtcttcagaagaagctcaagatggcgtagtttagttaggaagaagtaaaggtggctaatgtgcgcggtctatgtttgtggctataa |
100 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
47891745 |
gagaggagagtagagtcttcagaagaagctcaagatg-cgtagtttagttaggaagaagtaaaggtggctaatgtgcgcggtctatgtttgtggctataa |
47891647 |
T |
|
| Q |
101 |
aagaaccaagaagacgtgacaacatggacaaatatatagtaatcatga |
148 |
Q |
| |
|
|||||||||||||||||||||||||| ||||||||||||||||||||| |
|
|
| T |
47891646 |
aagaaccaagaagacgtgacaacatgtacaaatatatagtaatcatga |
47891599 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #2
Raw Score: 92; E-Value: 1e-44
Query Start/End: Original strand, 212 - 326
Target Start/End: Complemental strand, 47891526 - 47891411
Alignment:
| Q |
212 |
tgttgttgttgtttcttctacaaaaatctgggggaaatttttacgggttacagtttgtcttattttggtaaa-gtctaggtttttgtttatcggctttat |
310 |
Q |
| |
|
||||||||||| ||||||||||||||||||||||||||||||||| ||||| |||||||||||||||||||| ||||||||||||||||||||||||||| |
|
|
| T |
47891526 |
tgttgttgttgcttcttctacaaaaatctgggggaaatttttacgtgttacggtttgtcttattttggtaaaggtctaggtttttgtttatcggctttat |
47891427 |
T |
|
| Q |
311 |
taaacagtaaaactaa |
326 |
Q |
| |
|
||||||||||||||| |
|
|
| T |
47891426 |
caaacagtaaaactaa |
47891411 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University