View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF8228_low_22 (Length: 354)
Name: NF8228_low_22
Description: NF8228
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF8228_low_22 |
 | |
|
Alignment Details
Target: chr4 (Bit Score: 218; Significance: 1e-120; HSPs: 1)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 218; E-Value: 1e-120
Query Start/End: Original strand, 109 - 340
Target Start/End: Complemental strand, 31367970 - 31367742
Alignment:
| Q |
109 |
caacttaacctagatgctttgctaccattcacaaaggaactacacaaacacctatcttattctttagttctgtgcagtcactatccttcccatttaaact |
208 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
31367970 |
caacttaacctagatgctttgctaccattcacaaaggaactacacaaacacctatctt---ctttagttctgtgcagtcactatccttcccatttaaact |
31367874 |
T |
|
| Q |
209 |
caattctttttgtcctgaggtattgcctttctcctacatacaaaaaatttacataatggcataacttgttagttggaaatgcataaataaatcatatata |
308 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
31367873 |
caattctttttgtcctgaggtattgcctttctcctacatacaaaaaatttacataatggcataacttgttagttggaaatgcataaataaatcatatata |
31367774 |
T |
|
| Q |
309 |
catttcaacaaccaaacatgcatgtgaaacat |
340 |
Q |
| |
|
|||||||||||||||||||||||||||||||| |
|
|
| T |
31367773 |
catttcaacaaccaaacatgcatgtgaaacat |
31367742 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University