View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF8228_low_37 (Length: 250)
Name: NF8228_low_37
Description: NF8228
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF8228_low_37 |
 | |
|
Alignment Details
Target: chr1 (Bit Score: 224; Significance: 1e-123; HSPs: 1)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 224; E-Value: 1e-123
Query Start/End: Original strand, 1 - 240
Target Start/End: Complemental strand, 6656532 - 6656293
Alignment:
| Q |
1 |
agaaaatcacatgagactagcgcatatgagcagtaactggcagtccgcatttcttgataaaattgatccaagctacacgacttatatgattgtgtaaaga |
100 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||| ||||||||||||||||||||||||||||||| |
|
|
| T |
6656532 |
agaaaatcacatgagactagcgcatatgagcagtaactggcagtctgcatttcttgataaaattgatcaaagctacacgacttatatgattgtgtaaaga |
6656433 |
T |
|
| Q |
101 |
attataataccaagacttgatccttgttcagtcagtgtcagcatatctctcaaaacatggcataagcaactaacattatggtaaggtccagcataattta |
200 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
6656432 |
attataataccaagacttgatccttgttcagtcagtgtcagcatatctctcaaaacatggcataagcaactaacattatggtaaggtccagcataattta |
6656333 |
T |
|
| Q |
201 |
taaatggctgctattaaatgttttcatatcgtaagtatta |
240 |
Q |
| |
|
| ||||||||||||||||||||||||||||||||||||| |
|
|
| T |
6656332 |
ttgatggctgctattaaatgttttcatatcgtaagtatta |
6656293 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University