View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: NF8228_low_38 (Length: 248)

Name: NF8228_low_38
Description: NF8228
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] NF8228_low_38
NF8228_low_38
[»] chr4 (1 HSPs)
chr4 (12-138)||(21268953-21269079)


Alignment Details
Target: chr4 (Bit Score: 119; Significance: 7e-61; HSPs: 1)
Name: chr4
Description:

Target: chr4; HSP #1
Raw Score: 119; E-Value: 7e-61
Query Start/End: Original strand, 12 - 138
Target Start/End: Original strand, 21268953 - 21269079
Alignment:
12 aagcagagagtgaaaccggaaaagtaaccgtcaccggaaatgtggaccccacaaaactgagagacaatcttgctgagaagattaagaagaaagttgaact 111  Q
    ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||    
21268953 aagcagagagtgaaaccggaaaagtaaccgtcaccggaaatgtggaccccacaaaactgagagacaatcttgctgagaagattaagaagaaagttgaact 21269052  T
112 catgtcaccacttcccaagaaggataa 138  Q
    ||| |||||| ||||||||||||||||    
21269053 catttcaccaattcccaagaaggataa 21269079  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Oklahoma State University