View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF8228_low_38 (Length: 248)
Name: NF8228_low_38
Description: NF8228
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF8228_low_38 |
 |  |
|
Alignment Details
Target: chr4 (Bit Score: 119; Significance: 7e-61; HSPs: 1)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 119; E-Value: 7e-61
Query Start/End: Original strand, 12 - 138
Target Start/End: Original strand, 21268953 - 21269079
Alignment:
| Q |
12 |
aagcagagagtgaaaccggaaaagtaaccgtcaccggaaatgtggaccccacaaaactgagagacaatcttgctgagaagattaagaagaaagttgaact |
111 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
21268953 |
aagcagagagtgaaaccggaaaagtaaccgtcaccggaaatgtggaccccacaaaactgagagacaatcttgctgagaagattaagaagaaagttgaact |
21269052 |
T |
 |
| Q |
112 |
catgtcaccacttcccaagaaggataa |
138 |
Q |
| |
|
||| |||||| |||||||||||||||| |
|
|
| T |
21269053 |
catttcaccaattcccaagaaggataa |
21269079 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University