View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF8228_low_40 (Length: 244)
Name: NF8228_low_40
Description: NF8228
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF8228_low_40 |
 |  |
|
Alignment Details
Target: chr7 (Bit Score: 199; Significance: 1e-108; HSPs: 2)
Name: chr7
Description:
Target: chr7; HSP #1
Raw Score: 199; E-Value: 1e-108
Query Start/End: Original strand, 20 - 222
Target Start/End: Original strand, 33736886 - 33737088
Alignment:
| Q |
20 |
cttgttagttctagttatgcactttgttgatgaatttgtctctccccttagtgttatgtccagattaaataatgttttagttgctgctttgtggtcttct |
119 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
33736886 |
cttgttagttctagttatgcactttgttgatgaatttgtctcttcccttagtgttatgtccagattaaataatgttttagttgctgctttgtggtcttct |
33736985 |
T |
 |
| Q |
120 |
actagacctcgacctatcagtaacaaccaattgaattaaaatttggtatacttgaagaatgtgatagaatctcagaaaatcatatcatgtaggaagttat |
219 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
33736986 |
actagacctcgacctatcagtaacaaccaattgaattaaaatttggtatacttgaagaatgtgatagaatctcagaaaatcatatcatgtaggaagttat |
33737085 |
T |
 |
| Q |
220 |
gct |
222 |
Q |
| |
|
||| |
|
|
| T |
33737086 |
gct |
33737088 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #2
Raw Score: 31; E-Value: 0.00000002
Query Start/End: Original strand, 163 - 213
Target Start/End: Original strand, 33621247 - 33621296
Alignment:
| Q |
163 |
tggtatacttgaagaatgtgatagaatctcagaaaatcatatcatgtagga |
213 |
Q |
| |
|
|||||||| ||||||||||||||| ||||| ||||||||||||||||||| |
|
|
| T |
33621247 |
tggtatacgtgaagaatgtgatagt-tctcaaaaaatcatatcatgtagga |
33621296 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University