View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF8228_low_43 (Length: 237)
Name: NF8228_low_43
Description: NF8228
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF8228_low_43 |
 | |
|
Alignment Details
Target: chr4 (Bit Score: 167; Significance: 1e-89; HSPs: 2)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 167; E-Value: 1e-89
Query Start/End: Original strand, 54 - 220
Target Start/End: Complemental strand, 49861708 - 49861542
Alignment:
| Q |
54 |
cggaggtgttgacgtgtgcgatcacgtagaaggtagtatcgaattagaaaatggagacagagcattattatgataacggcgaagagaatgataatggcgg |
153 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
49861708 |
cggaggtgttgacgtgtgcgatcacgtagaaggtagtatcgaattagaaaatggagacagagcattattatgataacggcgaagagaatgataatggcgg |
49861609 |
T |
|
| Q |
154 |
ttagcattatcttgccgctgagggcataattgttttcgatttctctttcattatccatgttcgaatt |
220 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
49861608 |
ttagcattatcttgccgctgagggcataattgttttcgatttctctttcattatccatgttcgaatt |
49861542 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #2
Raw Score: 40; E-Value: 0.00000000000009
Query Start/End: Original strand, 1 - 40
Target Start/End: Complemental strand, 49861743 - 49861704
Alignment:
| Q |
1 |
cggacgggtccacgtaaaagatgaaaggttgacgacggag |
40 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
49861743 |
cggacgggtccacgtaaaagatgaaaggttgacgacggag |
49861704 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University