View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF8229_low_5 (Length: 227)
Name: NF8229_low_5
Description: NF8229
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF8229_low_5 |
 | |
|
Alignment Details
Target: chr6 (Bit Score: 116; Significance: 4e-59; HSPs: 1)
Name: chr6
Description:
Target: chr6; HSP #1
Raw Score: 116; E-Value: 4e-59
Query Start/End: Original strand, 1 - 128
Target Start/End: Complemental strand, 8849590 - 8849463
Alignment:
| Q |
1 |
cctgagtgtggcgttcttgctttgagttcgagaaggttacgtagaatgaaacgttcgagttcaatttcgccaaatccctctgtgacgatttcctcaaatc |
100 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||| |||||||||||||| ||||||||| ||||||||||||||||||||||||||||||||||||| |
|
|
| T |
8849590 |
cctgagtgtggcgttcttgctttgagttcgagaaggtaacgtagaatgaaaccttcgagttcgatttcgccaaatccctctgtgacgatttcctcaaatc |
8849491 |
T |
|
| Q |
101 |
cacccacggtatgacatttattaattat |
128 |
Q |
| |
|
|||||||||||||||||||||||||||| |
|
|
| T |
8849490 |
cacccacggtatgacatttattaattat |
8849463 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University