View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF8230_low_15 (Length: 242)
Name: NF8230_low_15
Description: NF8230
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF8230_low_15 |
 |  |
|
Alignment Details
Target: chr5 (Bit Score: 140; Significance: 2e-73; HSPs: 1)
Name: chr5
Description:
Target: chr5; HSP #1
Raw Score: 140; E-Value: 2e-73
Query Start/End: Original strand, 1 - 225
Target Start/End: Complemental strand, 15847087 - 15846858
Alignment:
| Q |
1 |
ataaaattttggtgcaagtgtttagttgttcatatgacaaaggaagtcattag------gcctcatggctgattgtggcagctatgtgattctggcagtg |
94 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||| |||||||||||| |||| |||| ||| |
|
|
| T |
15847087 |
ataaaattttggtgcaagtgtttagttgttcatatgacaaaggaagtcattagtcataggcctcatggctgac-gtggcagctatgcgattttggctgtg |
15846989 |
T |
 |
| Q |
95 |
attcggtgtttacaattattggtttcgtaagttaaaattgttgttagcatcccatattttactacaaacttccaaacaatgatcagagtcagagagttac |
194 |
Q |
| |
|
|| ||||||||||||||||||||||||| |||||||||||||||| |||||||||| ||| |||||||||||||||||||||||||||||||||||| |
|
|
| T |
15846988 |
gtttggtgtttacaattattggtttcgtacattaaaattgttgttagaatcccatattccacttcaaacttccaaacaatgatcagagtcagagagttac |
15846889 |
T |
 |
| Q |
195 |
atgataacatagtaagattgtaattacccct |
225 |
Q |
| |
|
||||||||||| |||||||||| | |||||| |
|
|
| T |
15846888 |
atgataacataataagattgtactcacccct |
15846858 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University