View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF8231_high_3 (Length: 255)
Name: NF8231_high_3
Description: NF8231
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF8231_high_3 |
 | |
|
Alignment Details
Target: chr4 (Bit Score: 170; Significance: 2e-91; HSPs: 2)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 170; E-Value: 2e-91
Query Start/End: Original strand, 1 - 240
Target Start/End: Original strand, 54084492 - 54084755
Alignment:
| Q |
1 |
aagcagagtagcaaggaaggatttgggtttggaccttggtgggttgggaattggacttggtgcaggagtaggcttgggaattggaggtggcagtggctct |
100 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
54084492 |
aagcagagtagcaaggaaggatttgggtttggacctcggtgggttgggaattggacttggtgcaggagtaggcttgggaattggaggtggcagtggctct |
54084591 |
T |
|
| Q |
101 |
ggagccggagcaggagctggct------------------ctggctctggttctagttct------tcctcaagttcatcatcatcttcatcttctagtt |
176 |
Q |
| |
|
|||||||||||||||||||||| |||||||||| ||| ||||| |||||||||||||||||||||||||||||||||| |
|
|
| T |
54084592 |
ggagccggagcaggagctggctctggagccggagcaggagctggctctggctctggttctagttcttcctcaagttcatcatcatcttcatcttctagtt |
54084691 |
T |
|
| Q |
177 |
ccggttccggttctggggcagggtcggaggcaggctcatatgcaggctctcgggctggttcggg |
240 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
54084692 |
ccggttccggttctggggcagggtcggaggcaggctcatatgcaggctctcgggctggttcggg |
54084755 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #2
Raw Score: 164; E-Value: 9e-88
Query Start/End: Original strand, 1 - 240
Target Start/End: Original strand, 54081113 - 54081352
Alignment:
| Q |
1 |
aagcagagtagcaaggaaggatttgggtttggaccttggtgggttgggaattggacttggtgcaggagtaggcttgggaattggaggtggcagtggctct |
100 |
Q |
| |
|
||||||||| || ||||||||||||||||||||||||||||| |||||||||||||||||||||||||| || || |||||||||||||||||||||||| |
|
|
| T |
54081113 |
aagcagagtggctaggaaggatttgggtttggaccttggtggattgggaattggacttggtgcaggagttggtttaggaattggaggtggcagtggctct |
54081212 |
T |
|
| Q |
101 |
ggagccggagcaggagctggctctggctctggttctagttcttcctcaagttcatcatcatcttcatcttctagttccggttccggttctggggcagggt |
200 |
Q |
| |
|
||||||||||| || || |||||||| ||||||||||| ||||||||||||||||| || ||||| ||||||||||| || || ||||| |||||||||| |
|
|
| T |
54081213 |
ggagccggagctggtgcaggctctggttctggttctagctcttcctcaagttcatcgtcctcttcgtcttctagttctgggtctggttccggggcagggt |
54081312 |
T |
|
| Q |
201 |
cggaggcaggctcatatgcaggctctcgggctggttcggg |
240 |
Q |
| |
|
|||| ||||||||||||||||||||||||||||||||||| |
|
|
| T |
54081313 |
cggaagcaggctcatatgcaggctctcgggctggttcggg |
54081352 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University