View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF8232_high_7 (Length: 292)
Name: NF8232_high_7
Description: NF8232
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF8232_high_7 |
 |  |
|
Alignment Details
Target: chr1 (Bit Score: 147; Significance: 2e-77; HSPs: 2)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 147; E-Value: 2e-77
Query Start/End: Original strand, 64 - 276
Target Start/End: Complemental strand, 7225394 - 7225175
Alignment:
| Q |
64 |
tattattttgacagatcaaataaaaacgtgcagtggacctgtgtaataa---atcataatataaatgatcgcctcaaaattgggagtgtctctttaaaat |
160 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||| |||||||||||||||||||||||||||| |
|
|
| T |
7225394 |
tattattttgacagatcaaataaaaacgtgcagtggacctgtgtaataataaatcataatataaatgatcggctcaaaattgggagtgtctctttaaaat |
7225295 |
T |
 |
| Q |
161 |
ttataacttaggttcctactacttagctcaatttataatgttgatattgctaagtt-----acttttatccggttttgaatatgagactttgtatttatc |
255 |
Q |
| |
|
|||||||| |||||||||||||||||||||| || ||||| ||||||||| ||||| |||||||| ||||||||||| |||||||||||||||||| |
|
|
| T |
7225294 |
ttataactcaggttcctactacttagctcaacttgtaatgctgatattgc-aagttttgacacttttattcggttttgaatctgagactttgtatttatc |
7225196 |
T |
 |
| Q |
256 |
acttcgtttacatacaaaaat |
276 |
Q |
| |
|
|||||||||||||| |||||| |
|
|
| T |
7225195 |
acttcgtttacatataaaaat |
7225175 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #2
Raw Score: 30; E-Value: 0.0000001
Query Start/End: Original strand, 16 - 49
Target Start/End: Complemental strand, 7225429 - 7225396
Alignment:
| Q |
16 |
tggtggtggctcggagtgggtggttggtcgcgga |
49 |
Q |
| |
|
||||||||||| |||||||||||||||||||||| |
|
|
| T |
7225429 |
tggtggtggctaggagtgggtggttggtcgcgga |
7225396 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University