View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF8232_low_3 (Length: 401)
Name: NF8232_low_3
Description: NF8232
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF8232_low_3 |
 | |
|
Alignment Details
Target: chr4 (Bit Score: 214; Significance: 1e-117; HSPs: 2)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 214; E-Value: 1e-117
Query Start/End: Original strand, 59 - 351
Target Start/End: Complemental strand, 55695280 - 55694985
Alignment:
| Q |
59 |
tgctgattctgtttcagtagtttctttagcctcttcagctgatacttcctctttcacttcgaccttttcaggttccgcgttctctacctctggcttggct |
158 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||| |||||||||||||||||||||| |
|
|
| T |
55695280 |
tgctgattctgtttcagtagtttctttagcctcttcagctgatacttcctctttcacttcgactttttcaggttccgggttctctacctctggcttggct |
55695181 |
T |
|
| Q |
159 |
tcctcagttacttgtgtactctcagcttcaactggaacttcagtttctcctttctccactgctactacttcttcggtggtggccggttctgaagtgggaa |
258 |
Q |
| |
|
|||| |||||||||||||||||||||||||| ||||||||||||||| | |||||||||||||||||||||||||||||||| |||||||||| |||| |
|
|
| T |
55695180 |
tcctgggttacttgtgtactctcagcttcaacgggaacttcagtttcttcattctccactgctactacttcttcggtggtggctggttctgaagcaggaa |
55695081 |
T |
|
| Q |
259 |
cctcagagccc---ggtgttgtttcctcgaccttggttaactcaactgtttcattttctgtcacggttgttgctacttgctgtgtttcaacctgca |
351 |
Q |
| |
|
|||| ||| || ||||||||||||||||||||||||| |||||||||||| ||||||||||| ||||||| | ||||||||||||||||||||| |
|
|
| T |
55695080 |
cctcggaggccggtggtgttgtttcctcgaccttggttacctcaactgtttccttttctgtcacagttgttggtgcttgctgtgtttcaacctgca |
55694985 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #2
Raw Score: 81; E-Value: 5e-38
Query Start/End: Original strand, 19 - 127
Target Start/End: Complemental strand, 55695392 - 55695284
Alignment:
| Q |
19 |
cttctgtggtggttacttcttccactggtactgctatggctgctgattctgtttcagtagtttctttagcctcttcagctgatacttcctctttcacttc |
118 |
Q |
| |
|
||||||||||||||||||||||||||||| ||||||| |||||||||||| ||||||||||||||||||||||||||| ||||||||||||||| |||| |
|
|
| T |
55695392 |
cttctgtggtggttacttcttccactggtgctgctattgctgctgattctatttcagtagtttctttagcctcttcagttgatacttcctcttttgcttc |
55695293 |
T |
|
| Q |
119 |
gaccttttc |
127 |
Q |
| |
|
||| ||||| |
|
|
| T |
55695292 |
gactttttc |
55695284 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University