View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF8232_low_9 (Length: 239)
Name: NF8232_low_9
Description: NF8232
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF8232_low_9 |
 |  |
|
Alignment Details
Target: chr1 (Bit Score: 166; Significance: 6e-89; HSPs: 1)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 166; E-Value: 6e-89
Query Start/End: Original strand, 14 - 223
Target Start/End: Complemental strand, 5420525 - 5420318
Alignment:
| Q |
14 |
agattattctagagcaaaagagattattcaaattcaacagttaggttcatattgctgtataatatagaagttgtagaggtctctaaaactgcacggtaat |
113 |
Q |
| |
|
||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
5420525 |
agattattctagagcaaaagagattattcaa------cagttaggttcatattgctgtataatatagaagttgtagaggtctctaaaactgcacggtaat |
5420432 |
T |
 |
| Q |
114 |
tgcaattttagccgtattggatgcattttgccgcgatataattgtccaaaa----tgtcactaggccgtaatctcaatttagaattatggttactggtta |
209 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||| |||||||||||||||||| ||||||| |
|
|
| T |
5420431 |
tgcaattttagccgtattggatgcattttgccgcgatataattgtccaaaatgtctgtcactaggccgtaatcacaatttagaattatggttgctggtta |
5420332 |
T |
 |
| Q |
210 |
tgcttacaaatatg |
223 |
Q |
| |
|
|||||||||||||| |
|
|
| T |
5420331 |
tgcttacaaatatg |
5420318 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University